Immunostimulatory Nucleic Acids

专利摘要:
The present invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. T-rich nucleic acids contain poly T sequences and / or have more than 25% T nucleotide residues. TG nucleic acids have TG dinucleotides. C-rich nucleic acids have one or more poly-C regions and / or more than 50% C nucleotides. These immunostimulatory nucleic acids act in a similar manner to nucleic acids containing CpG motifs. The present invention also includes preferred CpG nucleic acids.
公开号:KR20020068509A
申请号:KR1020027003845
申请日:2000-09-25
公开日:2002-08-27
发明作者:아써 엠. 크리그；크리스티안 쉐터；외르그 폴머
申请人:유니버시티 오브 아이오와 리써치 파운데이션；콜리 파마슈티칼 게엠베하；
IPC主号:

专利说明:

Immunostimulatory Nucleic Acids
[1] Bacterial DNA has an immunostimulatory effect of activating B cells and natural killer cells, but not in vertebrate DNA (Tokunaga, T., et al., Jpn. J. Cancer Res. 79: 682-686; Tokunaga, T., et al., 1984, JNCI 72: 955-962; Messina, JP, et al., 1991, J. Immunol. 147: 1759-1764; and reviewed in Krieg, 1998, In: Applied Oligonucleotide Technology, CA Stein and AM Krieg, (Eds.), John Wiley and Sons, Inc., New York, NY, pp. 431-448). Currently, this immunostimulatory effect of bacterial DNA is known to be due to the presence of unmethylated CpG dinucleotides in certain base contexts (CpG motifs) that are present in all bacterial DNA but not methylated in vertebrate DNA. (Krieg et al., 1995 Nature 374: 546-549; Krieg, 1999 Biochim. Biophys. Acta 93321: 1-10). Synthetic oligodeoxynucleotides (ODN) containing these CpG motifs can exhibit immunostimulatory effects of bacterial DNA. Such CpG ODNs may be used for B cell proliferation; Cytokine and immunoglobulin secretion; Natural killer (NK) cell lytic activity and IFN-γ secretion; And inducing activation of dendritic cells (DCs) and other antigen presenting cells that express costimulatory molecules and secrete Th1-like cytokines important for promoting the development of cytokines, particularly Th1-like T cell responses. And very stimulating effects on murine leukocytes. These immunostimulatory effects of the natural phosphodiester backbone CpG ODN are very specific for CpG in that the effect essentially disappears when the CpG motif is methylated or changed to GpC, or otherwise removed or altered (Krieg et al. , 1995 Nature 374: 546-549; Hartmann et al., 1999 Proc. Natl. Acad. Sci. USA 96: 9305-10). Phosphodiester CpG ODN can be formulated with lipids, alum or other forms of vehicle with depot properties or improved cell uptake to enhance immunostimulatory effects (Yamamoto et al, 1994 Microbiol. Immunol. 38: 831-836; Gramzinski et al., 1998 Mol. Med. 4: 109-118).
[2] In early studies, the expression of immunostimulatory CpG motifs was thought to be purine-purine-CpG-pyrimidine-pyrimidine (Krieg et al., 1995 Nature 374: 546-549; Pisetsky, 1996 J. Immunol. 156: 421- 423; Hacker et al., 1998 EMBO J. 17: 6230-6240; Lipford et al., 1998 Trends in Microbiol. 6: 496-500). Currently, however, mouse lymphocytes respond very well to phosphodiester CpG motifs that do not follow this "formula" (Yi et al., 1998 J. Immunol. 160: 5898-5906), and human B cells and dendritic cells also It has been clarified that it responds very well to phosphodiester CpG motifs that do not follow the above "formula" (Hartmann et al, 1999 Proc. Natl. Acad. Sci. USA 96: 9305-10; Liang, 1996 J. Clin. Invest. 98: 1119-1129).
[3] In the past, researchers have investigated whether the nucleotide content of an ODN can have an effect independently of the sequence of the ODN. Interestingly, it has been found that antisense ODN has a reduced frequency of TT or TCC nucleotide sequences compared to what would be expected if the content of the GG, CCC, CC, CAC and CG sequences is generally abundant and the base usage is random ( Smetsers et al., 1996 Antisense Nucleic Acid Drug Develop. 6: 63-67). This increased the likelihood that the rich sequence may contain the desired target element for the antisense oligonucleotide, or vice versa. One reason to avoid the use of thymidine-rich ODN in antisense ODN experiment glass decomposition by nucleases present in the cells to compete with ³ H- thymidine often used in experiments to measure cell proliferation thymidine (Matson et al, 1992 Antisense Research and Development 2: 325-330).
[4] Summary of the Invention
[5] The present invention relates to pyrimidine rich (Py-rich) immunostimulatory nucleic acids, which in part do not require the presence of a CpG motif, and in some embodiments, thymidine (T) rich immunostimulatory nucleic acids. The present invention also relates to the discovery that nucleic acids containing, in part, TG dinucleotide motifs are also immunostimulatory. The present invention is based in part on the unexpected finding that nucleic acids that do not contain a CpG motif are immunostimulatory. When analyzing the immunostimulatory properties of many nucleic acid sequences, it was found that these sequences may be Py-rich sequences, eg, T-rich sequences or may contain TG motifs. It was also found that these sequences preferentially activate non-rodent immune cells. Py-rich sequences and TG sequences have only minimal immunostimulatory to rodent immune cells compared to non-rodent immune cells. Thus, it is possible to induce an immune response in a non-rodent subject by administering a Py-rich immunostimulatory nucleic acid or a TG immunostimulatory nucleic acid according to the method of the invention. Py-rich immunostimulatory nucleic acids and TG immunostimulatory nucleic acids of the present invention may optionally comprise a CpG motif. This finding has important implications for the clinical development of immunostimulatory CpG containing nucleic acids and non-CpG containing nucleic acids.
[6] In one aspect, the invention is a pharmaceutical composition comprising an effective amount of an isolated Py-rich or TG immunostimulatory nucleic acid and a pharmaceutically acceptable carrier to stimulate an immune response. In another aspect, the invention is a substance composition comprising isolated Py-rich or TG immunostimulatory nucleic acid. In other embodiments, the immunostimulatory nucleic acid may be T rich. In other embodiments, the immunostimulatory nucleic acid may be T rich and have one or more TG motifs.
[7] Preferably, the Py-rich nucleic acid is a T-rich nucleic acid. In some embodiments, the T-rich immunostimulatory nucleic acid is a poly T nucleic acid comprising 5'TTTT3 '. In other embodiments, the poly T nucleic acid comprises 5′X ₁ X ₂ TTTTX ₃ X ₄ 3 ′ wherein X ₁ , X ₂ , X ₃ and X ₄ are nucleotides. In some embodiments, X ₁ X ₂ is TT and / or X ₃ X ₄ is TT. In other embodiments, X ₁ X ₂ is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA and GC; X ₃ X ₄ is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA and GC.
[8] T-rich immunostimulatory nucleic acids may have only a single poly T motif or may have multiple poly T nucleic acid motifs. In some embodiments, the T-rich immunostimulatory nucleic acid comprises at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight T motifs. In other embodiments, the nucleic acid comprises at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight CpG motifs. In a preferred embodiment, a number of CpG motifs and poly T motifs are interspersed.
[9] In other embodiments, at least one of the plurality of poly T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T nucleotide residues. In other embodiments, the plurality of poly T motifs are at least three motifs, wherein each of the three or more motifs comprises at least three contiguous T nucleotide residues, or the plurality of poly T motifs are at least four motifs, wherein 4 Each of the at least two motifs comprises at least three contiguous T nucleotide residues.
[10] In some cases, T-rich immunostimulatory nucleic acids may not have a poly T motif but may comprise a nucleotide composition with a T greater than 25%. In other embodiments, the T-rich immunostimulatory nucleic acid has a poly T motif and also comprises a nucleotide composition with a T greater than 25%. In a preferred embodiment, the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 35%, 40%, 50%, 60%, 80% or 90%. In an important embodiment, the nucleic acid has a T of at least 50%.
[11] The length of the T-rich and TG immunostimulatory nucleic acids may be greater than 7 nucleotides, but in some embodiments may be 8 to 100 nucleotide residues. In a preferred embodiment, the T-rich immunostimulatory nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27 nucleotides or at least 30 nucleotides. In a preferred embodiment, the TG immunostimulatory nucleic acid is 15-25 nucleotides in length. T-rich and TG immunostimulatory nucleic acids can be single stranded or double stranded.
[12] In one preferred embodiment, an immunostimulatory nucleic acid has a T-rich region located in the middle of its length (ie, approximately the same number of nucleotides flanking the T-rich region on the 5 'and 3' ends).
[13] In some embodiments, the T-rich nucleic acid is SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433 , 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908 and 910-913 It is selected from the group consisting of. In other embodiments, the T-rich nucleic acid is SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300 , 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687 , 692, 693, 804, 862, 883, 884, 888, 890 and 891.
[14] In other embodiments, the Py-rich immunostimulatory nucleic acid is a C-rich nucleic acid. An immunostimulatory C-rich nucleic acid is a nucleic acid comprising at least one, preferably at least two poly-C regions or at least 50% C nucleotides.
[15] Py-rich and TG immunostimulatory nucleic acids may comprise one or more CpG motifs. The motif may or may not be methylated. In other embodiments, the Py-rich and TG immunostimulatory nucleic acids are free of one or more CpG dinucleotides.
[16] In other embodiments, Py-rich and TG immunostimulatory nucleic acids also include poly-A, poly G, and / or poly C motifs. In other embodiments, the Py-rich or TG immunostimulatory nucleic acid does not have two poly C sequences of three or more contiguous C nucleotide residues, or two poly A sequences of three or more contiguous A nucleotide residues. In other embodiments, the Py-rich or TG immunostimulatory nucleic acid comprises a nucleotide composition greater than 25% C or greater than 25% A. In other embodiments, the Py-rich or TG immunostimulatory nucleic acid is free of poly-C sequences, poly-G sequences, or poly-A sequences.
[17] In some embodiments, the poly G nucleic acid is SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936 and 938. In other embodiments, the poly G nucleic acid is SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, County consisting of 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932 and 937 Is selected from.
[18] According to another aspect of the invention, an immunostimulatory nucleic acid can be defined as a nucleic acid having a TG motif, referred to herein as a TG immunostimulatory nucleic acid. In one embodiment, the TG nucleic acid comprises one or more TG dinucleotides having a sequence comprising one or more 5′N ₁ X ₁ TGX ₂ N ₂ 3 ′. In related embodiments, a number of nucleotides of N ₁ is (11-N ₂₎ to a nucleic acid sequence composed of a number of nucleotides of _{(21-N 2), N} 2 is a (11-N ₁₎ to (21-N ₁₎ Constructed nucleic acid sequences. In a preferred embodiment, X ₂ is thymidine.
[19] In other embodiments, the TG nucleic acid has one or more 5'X ₁ X ₂ TGX ₃ X ₄ 3 '. In another embodiment, the TG nucleic acid comprises the sequence 5'N ₁ X ₁ X ₂ TGX ₃ X ₄ N ₂ 3 '. In related embodiments, a number of nucleotides of N ₁ are (9-N ₂₎ to a nucleic acid sequence composed of a number of nucleotides of _{(19-N 2), N} 2 is (9-N ₁₎ to (19-N ₁₎ Constructed nucleic acid sequences. In a preferred embodiment, X ₃ is thymidine. X ₁ X ₂ is a nucleotide which may be selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, X ₃ X ₄ is TT, CT, AT, AG, Nucleotides that may be selected from the group consisting of CG, TC, AC, CC, TA, AA and CA. In some preferred embodiments, X ₃ is thymidine. In an important embodiment, X ₃ X ₄ is a nucleotide selected from the group consisting of TT, TC, TA and TG. In other embodiments, X ₁ X ₂ is GA or GT and X ₃ X ₄ is TT. In other embodiments, X ₁ , X ₂ or both are purines, X ₃ , X ₄ or both are pyrimidines, or X ₁ X ₂ is GpA and X ₃ , X ₄ or both are pyrimidines. In one embodiment, X ₂ is T and X ₃ is pyrimidine.
[20] In one embodiment, the 5'X ₁ X ₂ TGX ₃ X ₄ 3 'sequence, full length TG nucleic acid, or some fragment thereof, of a TG nucleic acid is a non-palindrome sequence, and in other embodiments a palindrome sequence.
[21] In some preferred embodiments, the TG nucleic acid is also enriched in T.
[22] In some embodiments the Py-rich and TG immunostimulatory nucleic acids have a nucleotide backbone comprising one or more backbone modifications, such as phosphorothioate modifications. The nucleotide backbone may be chimeric or, preferably, the entirety of the nucleotide backbone is modified. In one preferred embodiment, the immunostimulatory nucleic acid has a poly T motif and a phosphorothioate backbone.
[23] In another aspect, the invention is a composition of immunostimulatory nucleic acids and antigens in the form of Py-rich or TG nucleic acids, wherein the nucleic acids are free of unmethylated CpG motifs.
[24] Another composition of the invention is a Py-rich or TG immunostimulatory nucleic acid and an antibiotic, wherein the Py-rich or TG nucleic acid is free of unmethylated CpG motifs. Preferably, the antibiotic is selected from the group consisting of antiviral, antiparasitic, antibacterial and antifungal agents.
[25] A composition of a sustained release device comprising a Py-rich and / or TG immunostimulatory nucleic acid free of unmethylated CpG motifs is provided according to another aspect of the present invention.
[26] The present invention is a delivery device selected from the group consisting of capsules, pills, and sublingual tablets, which includes a nutritional supplement of Py-rich and / or TG immunostimulatory nucleic acids without an unmethylated CpG motif.
[27] If it is useful to administer Py-rich, eg, poly T, T-rich, C-rich or TG oligonucleotides and CpG oligonucleotides, Py with physically isolated CpG, Py-rich or TG oligonucleotides It should be understood that it may be desirable to administer abundant or TG oligonucleotides simultaneously. Alternatively, CpG, Py-rich or TG motifs may be present on the same contiguous nucleic acid as Py-rich or TG oligonucleotides. In further embodiments, separate nucleic acids or Py-rich, TG and CpG nucleic acids in the same nucleic acid molecule may be administered simultaneously or in some combination simultaneously. Simultaneous administration is to administer the nucleic acid close enough in time so that the two oligonucleotides can gain more benefits than their own combined advantage, preferably the benefit obtained by administering each oligonucleotide alone at the same dose.
[28] CpG oligonucleotides generally have the formula 5'X ₁ X ₂ CGX ₃ X ₄ 3 ', wherein X ₁ , X ₂ , X ₃ and X ₄ are nucleotides and at least C of CpG is not methylated. Preferred CpG oligonucleotides are 8 to 100 nucleotides in length and have a modified backbone. The specific structure is described in detail in published PCT applications, US applications and references cited herein, the disclosures of which are intended to be included herein. In one embodiment, the CpG oligonucleotides are free of poly T and TG motifs and are not T rich.
[29] In one embodiment, the CpG oligonucleotides comprise SEQ ID NOs: 1, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286-287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453- 456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648-650, 653- 664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 817, Sequence selected from the group consisting of 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904 and 909-913 Has
[30] In another embodiment, the Py-rich or TG oligonucleotides are free of CpG motifs. This embodiment of the invention provides two CpG oligonucleotides (which may be free of poly T and TG motifs and may not be T-rich), and Py-rich and / or TG oligonucleotides that are physically isolated from CpG oligonucleotides Also included are pharmaceutical compositions and kits containing the same. As described in detail herein for Py-rich and TG oligonucleotides, the pharmaceutical formulation is present in an effective amount and typically comprises a pharmaceutically acceptable carrier. The kit includes one or more containers containing oligonucleotides that are Py-rich or TG oligonucleotides (some combination thereof). In the same container, or in other embodiments, the second container may contain oligonucleotides having CpG motifs that may be free of Py-rich and / or TG motifs. The kit also includes instructions for administering the oligonucleotide to the subject. The kit may also include a container containing a solvent or diluent.
[31] In summary, as described in detail herein, CpG oligonucleotides that are physically isolated from Py-rich or TG oligonucleotides may be used with Py-rich or TG oligonucleotides in the methods, compositions, and products described above.
[32] In another aspect, the present invention relates to immunostimulatory oligonucleotides that have a chimeric backbone and do not require the presence of a CpG motif. The present invention is based, in part, on the discovery that nucleic acid sequences that do not contain a CpG motif are immunostimulatory and that nucleic acid sequences having a chimeric backbone have unexpectedly elevated immunostimulatory properties. Accordingly, the invention relates in one aspect to an oligonucleotide composition having the formula 5′Y ₁ N ₁ ZN ₂ Y ₂ 3 ′ wherein Y ₁ and Y ₂ are independently of one another a nucleic acid molecule having 1 to 10 nucleotides Y ₁ comprises one or more modified internucleotide bonds, Y ₂ comprises one or more modified internucleotide bonds, and N ₁ and N ₂ are independently a nucleic acid molecule having 0 to 5 nucleotides, but N ₁ ZN ₂ has up to 6 nucleotides in total, nucleotides of N ₁ ZN ₂ have a phosphodiester backbone, Z is an immunostimulatory nucleic acid motif but does not contain CG. In one embodiment, Z is a nucleic acid sequence selected from the group consisting of TTTT, TG, and sequences in which at least 50% of the bases of the sequence are T in base.
[33] In some embodiments, Y ₁ and / or Y ₂ have 3 to 8 nucleotides. In other embodiments, Y ₁ and / or Y ₂ are composed of at least 3 G, at least 4 G, at least 7 G and or all G. In other embodiments, Y ₁ and / or Y ₂ are selected from the group consisting of TCGTCG, TCGTCGT and TCGTCGTT (SEQ ID NO: 1145). In other embodiments, Y ₁ and / or Y ₂ comprise one or more, two or more, three or more, four or more or five or more poly-A, poly-T or poly-C sequences.
[34] The central nucleotide of formula 'Y ₁ N ₁ ZN ₂ Y ₂ (N ₁ ZN ₂ ) has phosphodiester internucleotide bonds, and Y ₁ and Y ₂ have one or more modified internucleotide bonds. In some embodiments, Y ₁ and / or Y ₂ have two or more modified internucleotide bonds. In other embodiments, Y ₁ and / or Y ₂ have two to five modified internucleotide bonds. In other embodiments, Y ₁ has two modified internucleotide bonds and Y ₂ has five modified internucleotide bonds, or Y ₁ has five modified internucleotide bonds and Y ₂ has two modified internucleotide bonds. Have In some embodiments, the modified internucleotide bond is a phosphorothioate modified bond, a phosphorodithioate modified bond or a p-ethoxy modified bond.
[35] Part of the formula Y ₁ N ₁ ZN ₂ Y ₂ may optionally form palindrom. Thus, in some embodiments, the nucleotides of N ₁ ZN ₂ form palindrom. In some embodiments, the palindrom is not a direct repeat. In other embodiments, the nucleotides of N ₁ ZN ₂ do not form palindrom.
[36] According to another embodiment, N ₁ ZN ₂ is GATTTTATCGTC (SEQ ID NO: 1098); TCGATTTTTCGA (SEQ ID NO: 1099); TCATTTTTATGA (SEQ ID NO: 1100); GTTTTTTACGAC (SEQ ID NO: 1101); TCAATTTTTTGA (SEQ ID NO: 1102); ACGTTTTTACGT (SEQ ID NO: 1103); TCGTTTTTACGA (SEQ ID NO: 1104); TCGATTTTTACGTCGA (SEQ ID NO: 1105); AATTTTTTAACGTT (SEQ ID NO: l106); TCGTTTTTTAACGA (SEQ ID NO: l107); ACGTTTTTTAACGT (SEQ ID NO: 1108); GATTTTTATCGTC (SEQ ID NO: 1109); GACGATTTTTCGTC (SEQ ID NO: 1110); GATTTTAGCTCGTC (SEQ ID NO: 1111); GATTTTTACGTC (SEQ ID NO: 1112); ATTTTATCGT (SEQ ID NO: 1113); AACGATTTTTCGTT (SEQ ID NO: 1114); TCACTTTTGTGA (SEQ ID NO: 1115); TCGTATTTTA (SEQ ID NO: 1116); ACTTTTGTACCGGT (SEQ ID NO: 1117); TCGATTTTTCGACGTCGA (SEQ ID NO: 1118); ACGATTTTTCGT (SEQ ID NO: 1119); GATGATCGTC (SEQ ID NO: 1120); TCGATGTCGA (SEQ ID NO: 1121); TCATGTATGA (SEQ ID NO: 1122); GTGTTACGAC (SEQ ID NO: 1123); TCAATGTTGA (SEQ ID NO: 1124); ACGTGTACGT (SEQ ID NO: 1125); TCGTGTACGA (SEQ ID NO: 1126); TCGATGTACGTCGA (SEQ ID NO: 1127); AATGTTAACGTT (SEQ ID NO: 1128); TCGTGTTAACGA (SEQ ID NO: 1129); ACGTGTTAACGT (SEQ ID NO: 1130); GATGTATCGTC (SEQ ID NO: 1131); GACGATGTCGTC (SEQ ID NO: 1132); GATGAGCTCGTC (SEQ ID NO: 1133); GATGTACGTC (SEQ ID NO: 1134); ATGATCGT (SEQ ID NO: 1135); AACGATGTCGTT (SEQ ID NO: 1136); TCACTGGTGA (SEQ ID NO: 1137); TCGTATGA (SEQ ID NO: 1138); ACTGGTACCGGT (SEQ ID NO: 1139); TCGATGTCGACGTCGA (SEQ ID NO: 1140); And ACGATGTCGT (SEQ ID NO: 1141).
[37] Compositions of the invention may optionally comprise a pharmaceutical carrier and / or may be formulated into a delivery device. In some embodiments, the delivery device is selected from the group consisting of cationic lipids, cell penetrating proteins, and sustained release devices. In one preferred embodiment, the sustained release device is a biodegradable polymer. In another embodiment, the sustained release device is a microparticle.
[38] In another aspect, the invention is a composition consisting of immunostimulatory oligonucleotides and antigens having the formula Y ₁ N ₁ ZN ₂ Y ₂ .
[39] Another composition of the present invention comprises an immunostimulatory oligonucleotide having the formula Y ₁ N ₁ ZN ₂ Y ₂ and an antibiotic therapeutic agent. Preferably, the antibiotic is selected from the group consisting of antiviral, antiparasitic, antibacterial and antifungal agents.
[40] Compositions of sustained release devices comprising immunostimulatory oligonucleotides having the formula Y ₁ N ₁ ZN ₂ Y ₂ are provided according to another aspect of the present invention.
[41] The present invention also includes nutritional supplements of immunostimulatory oligonucleotides having the formula Y ₁ N ₁ ZN ₂ Y ₂ in a delivery device selected from the group consisting of capsules, sublingual tablets and pills.
[42] In another aspect, the composition also includes an immunostimulatory nucleic acid having an unmethylated CG dinucleotide, TG dinucleotide, or Py-rich sequence, wherein the unmethylated CG dinucleotide, TG dinucleotide, or Py-rich sequence The immunostimulatory nucleic acid having a different sequence from the oligonucleotide including 5'Y ₁ N ₁ ZN ₂ Y ₂ 3 '.
[43] In some embodiments, the immunostimulatory nucleic acid having an unmethylated CG dinucleotide, TG dinucleotide, or Py-rich sequence has a complete phosphodiester backbone, and in other embodiments, an unmethylated CG dinucleotide, TG dinucleotide Or said immunostimulatory nucleic acid having a Py-rich sequence optionally has a modified backbone which may have an internucleotide bond selected from the group consisting of phosphorothioate, phosphorodithioate and p-ethoxy.
[44] In one embodiment, an immunostimulatory nucleic acid having an unmethylated CG dinucleotide comprises 5'X ₁ X ₂ CGX ₃ X ₄ 3 'wherein X ₁ , X ₂ , X ₃ and X ₄ are nucleotides. Has the formula In other embodiments, the immunostimulatory nucleic acid sequence comprises one or more formula 5'TCNTX ₁ X ₂ CGX ₃ X ₄ 3 ', wherein N is a nucleic acid sequence consisting of about 0-25 nucleotides, and one or more nucleotides are modified With internucleotide linkages, the nucleic acid has up to 100 nucleotides. According to some embodiments, X ₁ X ₂ is a nucleotide selected from the group consisting of GT, GG, GA and AA, and X ₃ X ₄ is a nucleotide selected from the group consisting of TT, CT and GT. In a preferred embodiment, X ₁ X ₂ is GA and X ₃ X ₄ is TT.
[45] In another embodiment, an immunostimulatory nucleic acid having an unmethylated CG dinucleotide comprises one or more of the following sequences: ATCGACTCTCGAGCGTTCTC (SEQ ID NO: 15); TCCATGTCGGTCCTGCTGAT (SEQ ID NO: 32); TCCATGTCGGTZCTGATGCT (SEQ ID NO: 31); ATCGACTCTCGAGCGTTZTC (SEQ ID NO: 18); TCCATGTCGGTCCTGATGCT (SEQ ID NO: 28); GGGGGG (SEQ ID NO: 12); TCCATGACGGTCCTGATGCT (SEQ ID NO: 35); TCCATGGCGGTCCTGATGCT (SEQ ID NO: 34); TCCATGACGTTCCTGATGCT (SEQ ID NO: 7); TCCATGTCGTTCCTGATGCT (SEQ ID NO: 38); GGGGTCAGTCTTGACGGGG (SEQ ID NO: 4l); TCCATGTCGCTCCTGATGCT (SEQ ID NO: 37); TCCATGTCGATCCTGATGCT (SEQ ID NO: 36); TCCATGCCGGTCCTGATGCT (SEQ ID NO: 33); TCCATAACGTTCCTGATGCT (SEQ ID NO: 3); TCCATGACGTTCCTGATGCT (SEQ ID NO: 7); TCCATGACGTCCCTGATGCT (SEQ ID NO: 39); TCCATCACGTGCCTGATGCT (SEQ ID NO: 48); TCCATGACGTTCCTGACGTT (SEQ ID NO: 10); ATGACGTTCCTGACGTT (SEQ ID NO: 70); TCTCCCAGCGCGCGCCAT (SEQ ID NO: 72); TCCATGTCGTTCCTGTCGTT (SEQ ID NO: 73); TCCATAGCGTTCCTAGCGTT (SEQ ID NO: 74); TCCTGACGTTCCTGACGTT (SEQ ID NO: 76); TCCTGTCGTTCCTGTCGTT (SEQ ID NO: 77); TCCTGTCGTTCCTTGTCGTT (SEQ ID NO: 52); TCCTTGTCGTTCCTGTCGTT (SEQ ID NO: 121); TCCTGTCGTTTTTTGTCGTT (SEQ ID NO: 208); TCGTCGCTGTTGTCGTTTCTT (SEQ ID NO: 120); TCCATGCGTTGCGTTGCGTT (SEQ ID NO: 81); TCCACGACGTTTTCGACGTT (SEQ ID NO: 82); TCGTCGTTGTCGTTGTCGTT (SEQ ID NO: 47); TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 46); TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO: 49); GCGTGCGTTGTCGTTGTCGTT (SEQ ID NO: 56); TGTCGTTTGTCGTTTGTCGTT (SEQ ID NO: 48); TGTCGTTGTCGTTGTCGTTGTCGTT (SEQ ID NO: 84); TGTCGTTGTCGTTGTCGTT (SEQ ID NO: 50); TCGTCGTCGTCGTT (SEQ ID NO: 51); And TGTCGTTGTCGTT (SEQ ID NO: 85). In another embodiment, the immunostimulatory nucleic acid having a Py-rich or TG sequence is a nucleic acid as described above.
[46] In another aspect, the present invention provides a pharmaceutical composition containing both an oligonucleotide having the formula Y ₁ N ₁ ZN ₂ Y ₂ and a CpG oligonucleotide (optionally free of poly T and TG motifs and may not be Py rich). And kits, wherein the Py-rich and / or TG oligonucleotides are physically isolated from oligonucleotides having the above formula Y ₁ N ₁ ZN ₂ Y ₂ . As described in detail herein, pharmaceutical compositions are present in an effective amount and typically comprise a pharmaceutically acceptable carrier. The kit includes one or more containers containing oligonucleotides having the formula Y ₁ N ₁ ZN ₂ Y ₂ . In the same container, or in other embodiments, the second container may optionally contain no Py-rich and / or TG motifs, and / or Cy-rich and / or TG oligonucleotides (some combinations thereof). It may contain oligonucleotides with motifs. The kit also contains instructions for administering the oligonucleotide to the subject. The kit may also include a container containing a solvent or diluent.
[47] In summary, oligonucleotides having the formula Y ₁ N ₁ ZN ₂ Y ₂ , physically isolated from CpG, Py-rich or TG oligonucleotides, as described in detail herein, may be used in the methods, compositions and products described above. It can be used with CpG, Py-rich or TG oligonucleotides.
[48] In another aspect, the invention relates to a pharmaceutical composition comprising two or more oligonucleotides of the invention and a pharmaceutically acceptable carrier, wherein the two or more oligonucleotides have different sequences.
[49] According to another aspect of the present invention a vaccine formulation is provided. The vaccine comprises any composition of the invention with an antigen.
[50] According to another aspect of the invention, a method of stimulating an immune response is provided. The method comprises administering to the non-rodent subject an amount of Py-rich or TG immunostimulatory nucleic acid effective to induce an immune response in the non-rodent subject. Preferably, Py-rich or TG immunostimulatory nucleic acids are administered orally, topically, mucosa (to mucosal surface), systemic, parenteral or intramuscularly in a sustained release device. When Py-rich or TG immunostimulatory nucleic acids are administered to the mucosal surface, they can be delivered in an amount effective to induce a mucosal or systemic immune response. In a preferred embodiment, the mucosal surface is selected from the group consisting of intraoral surface, intranasal surface, rectal surface, intravaginal surface and intraocular surface.
[51] In some embodiments, the method comprises exposing the subject to an antigen, wherein the immune response is an antigen-specific immune response. The antigen can be encoded by a nucleic acid vector that can be delivered to a subject. In some embodiments, the antigen is selected from the group consisting of tumor antigens, viral antigens, bacterial antigens, parasite antigens and peptide antigens.
[52] Py-rich or TG immunostimulatory nucleic acids can elicit a wide range of immune responses. For example, these immunostimulatory nucleic acids can be used to convert Th2 immune responses to Th1 immune responses. Py-rich and TG nucleic acids can also be used to activate immune cells such as leukocytes, dendritic cells, and NK cells. The activation is performed in vivo, in vitro or ex vivo by isolating immune cells from the subject and contacting the immune cells with an amount of Py-rich or TG immunostimulatory nucleic acid effective to activate the immune cells and administering the activated cells back to the subject. Can be done. In some embodiments, dendritic cells express cancer antigens. The dendritic cells can be exposed to cancer antigens in vitro.
[53] Immune responses caused by Py-rich and TG nucleic acids may also induce cytokine production, eg, production of IL-6, IL-12, IL-18, TNF, IFN-α and IFN-γ.
[54] In another embodiment, Py-rich and TG nucleic acids are useful for treating cancer. In addition, according to another aspect of the present invention, Py-rich and TG nucleic acids are useful for preventing cancer (eg, reducing the risk of developing cancer) in a subject at risk of developing cancer. Cancers include biliary tract cancer, breast cancer, uterine cancer, choriocarcinoma, colon cancer, endometrial cancer, gastric cancer, intraepithelial sarcoma, lymphoma, liver cancer, lung cancer (eg small cell and non-small cell) melanoma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate Cancer, rectal cancer, sarcoma, thyroid cancer and kidney cancer as well as other carcinomas and sarcomas. In some important embodiments, the cancer is selected from the group consisting of bone cancer, brain and central nervous system (CNS) cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, laryngeal cancer, oral cancer, skin cancer and testicular cancer.
[55] Py-rich and TG nucleic acids may optionally be used to increase the responsiveness of cancer cells to cancer therapy (eg, chemotherapy) when these Py-rich and TG immunostimulatory nucleic acids are administered with an anticancer agent. The chemotherapy may be chemotherapy, a vaccine (eg, dendritic cell vaccine or cancer antigen vaccine primed in vitro) or antibody based therapy. The antibody based therapy may, for example, comprise administering an antibody specific for a cell surface antigen of cancer cells, wherein the immune response results in antigen dependent cytotoxicity (ADCC). In one embodiment, the antibody is Ributtaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220 , MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, Limposide ( LymphoCide), CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART lD0 Ab, SMART ABL 364 Ab and It can be selected from the group consisting of ImmuRAIT-CEA.
[56] Thus, according to some aspects of the present invention, a subject suffering from or at risk of suffering from cancer receives an immunostimulatory nucleic acid and an anticancer agent. In some embodiments, the anticancer agent is selected from the group consisting of chemotherapeutic agents, immunotherapy agents, and cancer vaccines. Chemotherapeutic agents include methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil (5-fluorouracil), mitomycin C, bleomycin, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, meglamine GLA, valerubicin (valrubicin), carmustaine and polyferposan, MMI270, BAY 12-9566, RAS pamesyl transferase inhibitor, pamesyl transferase inhibitor, MMP, MTA / LY231514, LY264618 Lometexol, Glamolec, CI-994, TNP-470, Hicamtin / Topotecan, PKC412, Valspodar / PSC833, Novantrone Mitroxantrone, Metare Metaret / Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Insel1 / VX-710, VX-853, ZD0101 , ISI641, ODN 698, TA 2516 / Marmistat, BB2516 / Marmistat, CDP 845, D2163, PDl83805, DX8951f, Lemonal DP 2202, FK 317, Picibanil / OK -432, AD 32 / Valrubicin, Metastron / Strontium Derivatives, Temodal / Temozolomide, Evaset / Liposomal Doxorubicin (liposomal) doxorubicin, Yewtaxan / Placlitaxel, Taxol / Paclitaxel, Celload / Capecitabine, Furtulon / Doxifluri Doxifluridine, Cycloxax / oral paclitaxel, Oral Taxoid, SPU-077 / Cisplatin, HMR 1275 / Flavorpi Stone (Flavopiridol), CP-358 (774) / EGFR, CP-609 (754) / RAS oncozin inhibitor, BMS-182751 / oral platinum, UFT (Tegafur / uracil), Ergamisol / revamisol (Levamisole), Eniluracil / 776C85 / 5FU Enhancer, Capto / Levamisole, Captosar / Irinotecan, Tumodex / Ralitrexed, Ralitrexed Leustatin / Cladribine, Paxex / Paclitaxel, Doxil / Liposome Doxorubicin, Caryx / Liposome Doxorubicin, Fludara / Fludara Fludarabine, Pharmarubicin / Epirubicin, DepoCyt, ZD1839, LU 79553 / Bis-naphthalimide, LU 103793 / Dolastain, Captics Caetyx / liposome doxorubicin, gemzar / gemcitabine, ZD 0473 / anorined, YM ll6, iodine seed , CDK4 and CDK2 inhibitors, PARP inhibitors, D4809 / Dexifosamide, Ifes / Mesnex / Ifosamide, Bumon / Tenoniposide, paraple Latin / Carboplatin, Platinol / Cisplatin, Vepeside / Etoposide, ZD 9331, Taxotere / Docetaxel , Prodrugs of guanine arabinosides, taxane homologues, nitrosoureas, alkylating agents such as melphalan and cyclophosphamide, aminoglutethimide, asparaginase, Busulfan, carboplatin, Chlorombucil, Cytarabine HCI, Dactinomycin, Daunorubicin HCl, Estramustine Phosphate Sodium, Etoposide (VP16-213), Phloxuridine, Fluorouridine Louracil (5-FU), Flutamide, hydroxyurea (hydroxycarbamide), ifosfamide, interferon alpha-2a, alpha-2b, leuprolide acetate (LHRH-releasing factor homologue), romu CCNU, Mechlorethamine HCl (nitrogen mustard), mercaptopurine, mesna, mitotane (o.p'-DDD), mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl Streptozosin, Tamoxifen Citrate, Thioguanine, Thiotepa, Vinblastine Sulfate, Amsacrine (m-AMSA) Azacitidine, erythropoietin, Hexamethylmelamine (HMM), interleukin 2, Mitoguazone (methyl-GAG; Methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), semustine (methyl-CCNU), teniposide (VM-26) and vindesine sulfate, This is not restrictive.
[57] Immunotherapeutic agents include ributaxin, herceptin, kudramet, panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexsar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, Anti-VEGF, Jena Fax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT , Griomab-H, GNI-250, EMD-72000, Limposide, CMA 676, Monopalm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-26O, ANA Ab , SMART 1D10 Ab, SNMART ABL 364 Ab and ImmuRAIT-CEA, but is not limited thereto.
[58] Cancer vaccines include EGF, anti-idiotype cancer vaccine, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2 / neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL Terra Tope, BLP25 (MUC-1), liposome-type idiotype vaccine, melanin, peptide antigen vaccine, toxin / antigen vaccine, MVA-based vaccine, PACIS, BCG vaccine, TA-HPV, TA-CIN, DISC -Virus and Immunist / TheraCys can be selected from the group consisting of, but not limited to.
[59] In another embodiment of the method for preventing or treating cancer, the subject may further be administered interferon-α.
[60] The present invention, in one aspect, relates to a method for preventing a disease in a subject. The methods of the present invention comprise regularly administering Py-rich or TG immunostimulatory nucleic acids to a subject to promote an immune system response to prevent the subject's disease. Examples of diseases or conditions to be prevented using the prophylactic methods of the present invention include microbial infections (eg, sexually transmitted diseases), and anaphylactic shock due to food allergies.
[61] In another aspect, the invention is a method of inducing an innate immune response by administering to a subject an amount of Py-rich or TG immunostimulatory nucleic acid effective to activate the innate immune response.
[62] According to another aspect of the invention, a method of treating or preventing a viral or retroviral infection is provided. The method comprises administering to a subject at or at risk of being infected with a virus or retrovirus in an amount effective to treat or prevent a viral or retroviral infection. In some embodiments, the viral infection is caused by hepatitis virus, HIV, hepatitis virus B, hepatitis virus C, herpes virus or papillomavirus.
[63] According to another aspect of the invention there is provided a method of treating or preventing a bacterial infection. The method comprises administering to a subject at or at risk of being infected with a bacterium any of the compositions of the present invention in an amount effective to treat or prevent a bacterial infection. In one embodiment, the bacterial infection is due to intracellular bacteria.
[64] In another aspect, the invention relates to a method of treating or preventing a parasitic infection by administering to a subject infected or at risk of infecting any of the compositions of the composition of the invention in an amount effective to treat or prevent the parasitic infection. It is about. In one embodiment, the parasite infection is due to intracellular parasites. In another embodiment, the parasitic infection is due to a nonparasitic parasite.
[65] In some embodiments, the subject is a human, and in other embodiments, the subject is a non-human vertebrate selected from the group consisting of dogs, cats, horses, cattle, pigs, goats, fish, monkeys, chickens, and sheep.
[66] In another aspect, the invention relates to a method of treating or preventing asthma by administering to a subject having asthma or at risk of having asthma an amount of any of the compositions of the invention effective to treat or prevent asthma. will be. In one embodiment, the asthma is allergic asthma.
[67] In another aspect, the invention relates to a method of treating or preventing allergy. The method comprises administering to a subject suffering from or at risk of suffering from an allergy in any of the compositions of the invention in an amount effective to treat or prevent the allergy.
[68] The present invention relates to a method for treating or preventing immunodeficiency according to another aspect. The method comprises administering to a subject suffering from or at risk of suffering from an immunodeficiency an amount of any of the compositions of the present invention effective to treat or prevent immunodeficiency.
[69] In one aspect, the invention relates to a method of inducing a TH1 immune response by administering to a subject an amount of any composition of the invention effective to elicit a TH1 immune response.
[70] In one embodiment, the methods of the present invention administer an oligonucleotide of formula 5'Y ₁ N ₁ ZN ₂ Y ₂ 3 'and an immunostimulatory nucleic acid having an unmethylated CG dinucleotide, TG dinucleotide or T-rich sequence. It involves doing. In an embodiment, the oligonucleotide comprising 5'Y ₁ N ₁ ZN ₂ Y ₂ 3 'is administered separately from the immunostimulatory nucleic acid. In some embodiments, oligonucleotides comprising 5′Y ₁ N ₁ ZN ₂ Y ₂ 3 ′ and immunostimulatory nucleic acids are administered weekly in turn, and in other embodiments, 5′Y ₁ N ₁ ZN ₂ Y ₂ 3 ′ Oligonucleotides and immunostimulatory nucleic acids comprising an alternating administration every two weeks.
[71] In another aspect, the invention provides a composition comprising an amount of an immunostimulatory nucleic acid and an anticancer agent effective to treat cancer or reduce the risk of developing cancer and formulated in a pharmaceutically acceptable carrier. In an important embodiment, the immunostimulatory nucleic acid is selected from the group consisting of T-rich nucleic acid, TG nucleic acid and C-rich nucleic acid.
[72] In addition, the present invention provides a kit comprising a first container containing an immunostimulatory nucleic acid and one or more other containers (eg, a second container) containing an anticancer agent and instructions for use. In one embodiment, the kit also includes interferon-α, which may be contained separately in another container (eg, a third container). In an important embodiment, the kit comprises a sustained release vehicle containing immunostimulatory nucleic acid, and one or more containers containing an anticancer agent and instructions for time of administration thereof. The immunostimulatory nucleic acid may be selected from the group consisting of Py-rich nucleic acid, TG nucleic acid and CpG nucleic acid, wherein the CpG nucleic acid has a nucleotide sequence comprising SEQ ID NO: 246.
[73] The present invention also provides a method of preventing or treating asthma or allergy, comprising administering an amount of an immunostimulatory nucleic acid and an asthma / allergic agent effective to treat or prevent asthma or allergy. In an important embodiment, the immunostimulatory nucleic acid is selected from the group consisting of T-rich nucleic acid, TG nucleic acid and C-rich nucleic acid.
[74] In one embodiment, the immunostimulatory nucleic acid is a T-rich nucleic acid. In related embodiments, the T-rich nucleic acid is SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433 , 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908 and 910-913 It has a nucleotide sequence selected from the group consisting of. In other embodiments, the T-rich nucleic acid is SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300 , 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687 , 692, 693, 804, 862, 883, 884, 888, 890 and 891.
[75] In further related embodiments, the T-rich nucleic acid is not a TG nucleic acid. In another embodiment, the T-rich nucleic acid is not a CpG nucleic acid.
[76] In one embodiment, the immunostimulatory nucleic acid is a TG nucleic acid. Further, in related embodiments, the TG nucleic acid is not a T-rich nucleic acid. In another related embodiment, the TG nucleic acid is not a CpG nucleic acid.
[77] In one embodiment, the immunostimulatory nucleic acid is a CpG nucleic acid, which CpG nucleic acid has a nucleotide sequence comprising SEQ ID NO: 246.
[78] In another embodiment, the asthma / allergic agent is a PDE-4 inhibitor, a broncodulator / beta-2 agonist, a K + channel opener, a VLA-4 antagonist, a neurokine antagonist, a TXA2 synthesis inhibitor, a xanthine, an arachidonic acid antagonist , 5 lipoxygenase inhibitors, thromboxin A2 receptor antagonists, thromboxane A2 antagonists, inhibitors of 5-lipox activating proteins and protease inhibitors, but are not limited thereto. In some important embodiments, the asthma / allergic agent is a broncodilator / beta-2 antagonist selected from the group consisting of salmeterol, salbutamol, terbutalin, D2522 / formoterol, phenoterol and orsiprenaline .
[79] In another embodiment, the asthma / allergic agent is an agent selected from the group consisting of anti-histamine and prostaglandin inducers. In one embodiment, the anti-histamine is loratidine, cetirizine, buclizin, the ceteridin homologue, fexofenadine, terfenadine, desloratadine, norastemizole, efinastin, evastin, astemizol, levocarbastin It is selected from the group consisting of azelastine, tranilast, terpenadine, mizolastine, betastatin, CS 560 and HSR 609. In another embodiment, the prostaglandin inducer is S-5751.
[80] In another embodiment, the asthma / allergic agent is selected from the group consisting of steroids and immunomodulators. The immunomodulators include anti-inflammatory agents, leukotriene antagonists, IL4 muteins, soluble IL-4 receptors, immunosuppressants, anti-IL-4 antibodies, IL-4 antagonists, anti-IL-5 antibodies, soluble IL-13 receptor-Fc But may be selected from the group consisting of fusion proteins, anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists, VLA-4 inhibitors, and down regulators of IgE. In one embodiment, the downregulator of IgE is anti-IgE.
[81] In another embodiment, the steroid is selected from the group consisting of beclomethasone, fluticasone, tramcinolone, budesonide, and budesonide. In further embodiments, the immunosuppressive agent is a resistant peptide vaccine.
[82] In one embodiment, the immunostimulatory nucleic acid is administered concurrently with the asthma / allergic agent. In another embodiment, the subject is an immunocompromised subject.
[83] The immunostimulatory nucleic acids administered to a subject in the methods disclosed herein relating to the prevention and treatment of asthma / allergy are as described for other method aspects of the present invention.
[84] In another aspect, the invention provides a kit comprising a first container containing an immunostimulatory nucleic acid and one or more other containers (eg, a second container) containing an asthma / allergic agent and instructions for use. Immunostimulatory nucleic acids useful in this kit are as disclosed herein. In an important embodiment, the immunostimulatory nucleic acid is selected from the group consisting of T-rich nucleic acid, TG nucleic acid and C-rich nucleic acid. In another important embodiment, the kit comprises a sustained release vehicle containing immunostimulatory nucleic acids, and one or more containers containing instructions for asthma / allergic agents and the time of administration of these agents. Asthma / allergic agents can be selected from the group consisting of asthma / allergic agents described in the above methods for the prevention or treatment of asthma / allergy.
[85] In another aspect, the present invention comprises a composition formulated in a pharmaceutically acceptable carrier, comprising an amount of an immunostimulatory nucleic acid and an asthma / allergic agent effective to prevent or treat an immune response associated with exposure to a mediator of asthma or allergy. To provide. Immunostimulatory nucleic acids can be selected from the group consisting of immunostimulatory nucleic acids described for the methods and compositions. In an important embodiment, the immunostimulatory nucleic acid is selected from the group consisting of T-rich nucleic acid, TG nucleic acid and C-rich nucleic acid. Asthma / allergic agents can be selected from the group consisting of asthma agents and allergic agents described in the methods and compositions.
[86] In a further aspect, the present invention provides SEQ ID NO: 95-136, SEQ ID NO: 138-152, SEQ ID NO: 154-222, SEQ ID NO: 224-245, SEQ ID NO: 247-261, SEQ ID NO: 263-299, SEQ ID NO: 301, SEQ ID NO: 303-4109, SEQ ID NO: 414-420, Provided are compositions comprising an immunostimulatory nucleic acid selected from the group consisting of SEQ ID NO: 424, SEQ ID NO: 426-947, SEQ ID NO: 959-1022 and SEQ ID NO: 1024-1093 and a pharmaceutically acceptable carrier. Preferably, the immunostimulatory nucleic acid is present in the composition in an effective amount. In one embodiment, the immunostimulatory nucleic acid is present in an amount effective to induce an immune response. In another embodiment, the immunostimulatory nucleic acid is present in an amount effective to prevent or treat cancer. In further embodiments, the immunostimulatory nucleic acid is present in an amount effective to prevent or treat asthma / allergy. The present invention provides a kit comprising any of the above immunostimulatory nucleic acid compositions and instructions for use.
[87] In another aspect, the invention encompasses a composition of immunostimulatory nucleic acids consisting essentially of 5'M ₁ TCGTCGTTM ₂ 3 ', wherein at least one C is not methylated and M ₁ is a nucleic acid having at least one nucleotide , M ₂ is a nucleic acid having from 0 to 50 nucleotides, and said immunostimulatory nucleic acid has less than 100 nucleotides.
[88] In another aspect, the invention relates to a pharmaceutical composition comprising an immunostimulatory nucleic acid and a sustained release device comprising 5'TCGTCGTT3 ', wherein at least one C is not methylated and the immunostimulatory nucleic acid is less than 100 nucleotides and Phosphodiester backbone. In some embodiments, the sustained release device is a microparticle. In other embodiments, the composition comprises an antigen.
[89] Each limitation of the present invention may encompass various embodiments of the present invention. Accordingly, it is anticipated that each limitation of the present invention, including any one element or combination of elements, may be included in each aspect of the present invention.
[90] 1A is a bar graph showing CD86 (Y-axis) expression by these cells after exposure of CD19 + cells to oligonucleotides at a concentration of 0.15 μg / ml described on the X-axis.
[91] 1B is a bar graph showing CD86 (Y-axis) expression by these cells after exposure of CD19 + cells to oligonucleotides at a concentration of 0.30 μg / ml described on the X-axis.
[92] 2 is a graph comparing the ability of ODN 2137, ODN 2177, ODN 2200 and ODN2202 to stimulate B cell proliferation at concentrations of 0.2 μg / ml to 20 μg / ml.
[93] 3 is a graph comparing the ability of ODN 2188, ODN 2189, ODN 2190 and ODN 2182 to stimulate B cell proliferation at concentrations of 0.2 μg / ml to 20 μg / ml.
[94] 4 is a histogram showing dose-dependent B cell activation induced by non-CpG ODN. PBMCs of blood donors are incubated with the specified concentrations of ODN 2006 (SEQ ID NO: 246), ODN 2117 (SEQ ID NO: 358), ODN 2137 (SEQ ID NO: 886), ODN 5126 (SEQ ID NO: 1058), and ODN 5162 (SEQ ID NO: 1094), and CD19 (B Staining with mAb for cell marker) and CD86 (B cell activation marker, B7-2). Expression was measured by flow cytometry.
[95] 5 is a histogram showing the stimulation of B cells by various sets of non-CpG ODNs. A representative donor's PBMC was 0.4 μg / ml, 1.0 μg / ml or 10.0 μg / ml of ODN 2006 (SEQ ID NO: 246), ODN 2196 (SEQ ID NO: 913), ODN 2194 (SEQ ID NO: 911), ODN 5162 (SEQ ID NO: 1094), ODN Stimulated with 5163 (SEQ ID NO: 1095), ODN 5168 (SEQ ID NO: 1096), and ODN 5169 (SEQ ID NO: 1097), and expression of the activation marker CD86 (B7-2) on CD19-positive B cells was measured by flow cytometry.
[96] 6 is a bar graph showing stimulation of B cells by non-CpG ODN 1982 and 2041. PBMCs were incubated with designated concentrations of ODN 2006 (SEQ ID NO: 246), ODN 1982 (SEQ ID NO: 225), and ODN2041 (SEQ ID NO: 282), and B cell expression (expression of activation marker CD86) was measured by flow cytometry.
[97] 7 is a histogram showing that NK cells are activated by non-CpG ODN. PBMC with 6 μg / ml ODN 2006 (SEQ ID NO: 246), ODN 2117 (SEQ ID NO: 358), ODN 2137 (SEQ ID NO: 886), ODN 2183 (SEQ ID NO: 433), ODN 2194 (SEQ ID NO: 911), and ODN 5126 (SEQ ID NO: 1058). Incubated and stained with mAbs for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (initial activation marker). Expression of CD69 on CD56-positive NK cells was measured by flow cytometry.
[98] 8 is a bar graph showing that NK-mediated cytotoxicity is elevated by non-CpG ODN. PNKC was incubated with 6 μg / ml of ODN 2006 (SEQ ID NO: 246), ODN 2194 (SEQ ID NO: 911), and ODN 5126 (SEQ ID NO: 1058) overnight before measuring NK-mediated lysis of K-562 target cells.
[99] 9 is a bar graph showing that NKT cells can be activated by non-CpG ODN. Representative donor PBMCs were prepared at 6 μg / ml ODN 2006 (SEQ ID NO: 246), ODN 2117 (SEQ ID NO: 358), ODN 2137 (SEQ ID NO: 886), ODN 2183 (SEQ ID NO: 433), ODN 2194 (SEQ ID NO: 911), and ODN 5126 (SEQ ID NO: 6). 1058) and incubated for 24 hours, staining cells with mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (initial activation marker), and then measuring the activation of NKT cells by flow cytometry It was.
[100] 10 is a bar graph showing stimulation of monocytes by various CpG and non-CpG ODNs. PBMC at 6 μg / ml ODN 2006 (SEQ ID NO: 246), ODN 2117 (SEQ ID NO: 358), ODN2137 (SEQ ID NO: 886), ODN 2183 (SEQ ID NO: 433), ODN 2194 (SEQ ID NO: 911), ODN 5126 (SEQ ID NO: 1058), and ODN 5163. (SEQ ID NO: 1095) and incubated with CD14 (monocyte marker) and CD80 (B7-1, activation marker). Expression was measured by flow cytometry.
[101] 11 is a bar graph showing the release of TNFα when incubating human cells with non-CpG ODN. PBMCs were incubated with or alone with 6 μg / ml of ODN described or 1 μg / ml of LPS as a positive control and TNFα was measured by ELISA.
[102] 12 is a bar graph showing the release of IL-6 after incubation with non-CpG ODN shows the same pattern as for TNFα. PBMCs were incubated with the described ODN (1.0 μg / ml) and IL-6 in the supernatant was measured by ELISA.
[103] In one aspect, the invention includes the discovery that Py-rich and preferably thymidine (T) rich nucleic acids, as well as nucleic acids comprising TG dinucleotide motifs, are effective in mediating immunostimulatory effects. It was previously known that CpG containing nucleic acids are therapeutic and prophylactic compositions that stimulate the immune system to treat cancer, infectious diseases, allergies, asthma and other diseases and protect against opportunistic infections after cancer chemotherapy. Strong but balanced cellular and humoral immune responses resulting from CpG stimulation reflect the body's natural defense system against invading pathogens and cancer cells. CpG sequences, which are relatively rare in human DNA, are commonly found in the DNA of infectious organisms such as bacteria. The human immune system has obviously evolved to recognize CpG sequences, such as early warning signs of infection, and to initiate an immediate strong immune response against invading pathogens without causing side effects often seen with other immunostimulants. Thus, CpG containing nucleic acids that rely on this innate immune defense mechanism may utilize the only natural route to immunotherapy. The effect of CpG nucleic acids on immune regulation has been found by the inventors and co-pending patent applications such as US patent application Ser. No. 08 / 386,063 filed Jul. 2, 1995; related PCT / US95 / 01570; 08 / 738,652 filed October 30, 1996; 08 / 960,774 filed October 30, 1997; related PCT / US97 / 19791, WO 98/18810; 09 / 191,170 filed November 13, 1998; 09 / 030,701 (filed February 25, 1998; related PCT / US98 / 03678); 09 / 082,649 filed May 20, 1998; related PCT / US98 / 10408; 09 / 352,193 (filed June 3, 1999; related PCT / US98 / 04703); 09 / 286,098, filed April 2, 1999; related PCT / US99 / 07335; No. 09 / 306,281, filed May 6, 1999; related PCT / US99 / 09863. The entire contents of each of these patents and patent applications are intended to be included herein.
[104] The findings of the present invention can be applied to all of the above uses of CpG containing nucleic acids, as well as any other known uses for CpG nucleic acids. In one aspect, the present invention includes the discovery that Py-rich, preferably T-rich nucleic acids and TG nucleic acids have similar immunostimulatory properties to CpG oligonucleotides, with or without the presence of CpG motifs. Thus, the present invention is useful in any method of stimulating the immune system using Py-rich or TG nucleic acids. The inventors have found that, according to the present invention, chimeric oligonucleotides without CpG motifs exhibit immunostimulatory properties and have many of the same prophylactic and therapeutic activities as CpG oligonucleotides.
[105] Py-rich nucleic acids are T-rich or C-rich immunostimulatory nucleic acids. In some embodiments, T-rich nucleic acids are preferred. T-rich nucleic acids are nucleic acids that contain one or more poly-T sequences and / or have a nucleotide composition of more than 25% T nucleotide residues. A nucleic acid having a poly-T sequence comprises four or more contiguous T's, such as 5'TTTT3 '. Preferably, the T-rich nucleic acid comprises one or more poly T sequences. In a preferred embodiment, the T-rich nucleic acid may have two, three, four, etc. poly T sequences, such as oligonucleotide 2006 (SEQ ID NO: 246). One of the highest immunostimulatory T-rich oligonucleotides found in accordance with the present invention is a nucleic acid consisting entirely of T nucleotide residues, eg oligonucleotide 2183 (SEQ ID NO: 433). Other T-rich nucleic acids according to the present invention have a nucleotide composition consisting of more than 25% T nucleotide residues, but do not necessarily include poly T sequences. In these T-rich nucleic acids, the T nucleotide residues may be separated from each other by different types of nucleotide residues, namely G, C and A. In some embodiments, the T-rich nucleic acid has a nucleotide composition with T nucleotide residues greater than 35%, 40%, 50%, 60%, 70%, 80%, 90% and 99%. Preferably, the T-rich nucleic acid comprises one or more poly T sequences and has a nucleotide composition of more than 25% T nucleotide residues.
[106] In the present invention, it was found that the T content of ODN significantly influences the immunostimulatory effect of ODN and that T-rich ODN can activate multiple human immune cell types in the absence of any CpG motif. Oligonucleotides having a 3 'poly-T region and two 5'CGs, for example ODN 2181 (SEQ ID NO: 431), have high immunostimulatory properties. Similar lengths of oligonucleotides ODN 2116 (SEQ ID NO: 357) containing two CG dinucleotides at the 5 'end and a poly-C region at the 3' end are immunostimulatory, but T-rich oligos when using standard experimental conditions Have somewhat lower immunostimulatory properties than nucleotides. Thus, even though C and T have nearly identical structures, their effects on the immunity of ODN are different. Both can induce an immune response to different degrees. Thus, while both T-rich and C-rich oligonucleotides are useful according to the invention, T-rich oligonucleotides are preferred. Moreover, if the T content of ODN is reduced by the incorporation of other bases such as G, A or C, the immunostimulatory effect is reduced [ODN # 2188 (SEQ ID NO: 905), 2190 (SEQ ID NO: 907), 2191 (SEQ ID NO: 908) and 2193 (SEQ ID NO: 910).
[107] C-rich nucleic acids are nucleic acid molecules that have at least one, preferably at least two, poly-C regions but consist of at least 50% C nucleotides. There are at least four contiguous C residues in the poly-C region. Thus, the poly-C region is represented by the formula 5'CCCC3 '. In some embodiments, it is preferred that the poly-C region has the formula 5'CCCCCC3 '. Other C-rich nucleic acids according to the present invention have a nucleotide composition consisting of more than 50% C nucleotide residues, but do not necessarily comprise a poly C sequence. In these C-rich nucleic acids, the C nucleotide residues may be separated from each other by different types of nucleotide residues, namely G, T and A. In some embodiments, the C-rich nucleic acid has a nucleotide composition with C nucleotide residues greater than 60%, 70%, 80%, 90% and 99%. Preferably, the C-rich nucleic acid comprises one or more poly C sequences, has a nucleotide composition of more than 50% C nucleotide residues, and in some embodiments also includes T in the C-rich nucleic acid.
[108] As described in the Examples, the past, comprising two ODN sequences 225 and SEQ ID NO: 282 (Takahashi, T et al. 2000, J. Immuno. 164: 4458), described in the past as non-irritant and mainly used as control ODNs Several ODNs that have been thought to be non-immunostimulatory have been shown to be immunostimulatory. Our experiments demonstrated that these ODN can stimulate B cells even if they stimulate B cells at higher concentrations compared to CpG ODN (FIG. 6). In at least some experiments, long poly T ODN (30mer) induced B cell activation that was comparable to one of B cell's most potent CpG ODN activators. These experiments have shown surprising findings that poly C ODN can also stimulate B cells.
[109] However, immune stimulation by these ODN was not limited to human B cells. Various experimental analyzes clearly demonstrated that monocytes, NK cells, and even NKT cells can be activated by non-CpG ODN (FIGS. 7-10). In contrast to the poly T and poly C sequences, there was no immunostimulation (at least against monocytes, B and NK cells) by the poly A sequence. Interestingly, introduction of the CpG motif into SEQ ID NO: 225 resulted in increased immunostimulatory activity, whereas longer poly T stretch did not result in elevated immunostimulation. This suggests that CpG and T-rich ODN may act through other mechanisms or pathways. It is also possible that the immunostimulatory properties may change when the poly-T motif is inserted at various positions in SEQ ID NO: 225.
[110] As used herein, a "TG nucleic acid" or "TG immunostimulatory nucleic acid" contains one or more TpG dinucleotides ("TG DNA", or thymidine-guanine dinucleotide sequences, ie 5 'thymidine followed by 3' guanine and phosphate Nucleic acid containing DNA linked by binding) and activates components of the immune system.
[111] In one embodiment, the present invention provides a TG nucleic acid represented by at least the formula 5'N ₁ X ₁ TGX ₂ N ₂ 3 '. Wherein X ₁ and X ₂ are nucleotides, N is any nucleotide, and N ₁ and N ₂ are nucleic acid sequences consisting of any number of N, provided the sum of N ₁ and N ₂ is 11-21. For example, if N ₁ is 5, N ₂ may be 6 (derives the total length of oligonucleotide consisting of 15 nucleotides). The TG may be located at any position within the oligonucleotide stretch, including the 5 'end, the middle, and the 3' end. Accordingly, N ₁ may be 0 to 21, provided that N ₂ is appropriately selected so that the sum of N ₂ and N ₁ is 11 to 21. Similarly, N ₂ may be 0 to 21, provided that it is appropriately selected so that the sum of N ₁ and N ₂ is 11 to 21. In some embodiments, X ₁ is adenine, guanine or thymidine and X ₂ is cytosine, adenine or thymidine. In one preferred embodiment, X ₂ is thymidine. In other embodiments, X ₁ is cytosine and / or X ₂ is guanine. As discussed herein, in other embodiments, the nucleic acid may also include other motifs that are long enough to stimulate the immune system.
[112] In other embodiments, the TG nucleic acid provides a TG nucleic acid represented by at least the formula 5'N ₁ X ₁ TGX ₃ X ₄ N ₂ 3 '. Wherein X ₁ , X ₂ , X ₃ and X ₄ are nucleotides. In some embodiments, X ₁ X ₂ is a nucleotide selected from the group consisting of GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, TpA and TpT; X ₃ X ₄ is a nucleotide selected from the group consisting of TpT, CpT, ApT, ApG, TpC, ApC, CpC, TpA, ApA and CpA; N is any nucleotide, and N ₁ and N ₂ are nucleic acids consisting of any number of nucleotides, provided the sum of N ₁ and N ₂ is 9 to 19. In some embodiments, X ₁ X ₂ is GpA or GpT and X ₃ X ₄ is TpT. In other embodiments, X ₁ or X ₂ or both are purines and X ₃ or X ₄ or both are pyrimidines; Or X ₁ X ₂ is GpA and X ₃ or X ₄ or both are pyrimidines. In one preferred embodiment, X ₃ X ₄ is a nucleotide selected from the group consisting of TpT, TpC and TpA.
[113] Immunostimulatory nucleic acids can be of any size (ie, length), provided they are at least 4 nucleotides. In an important embodiment, the immunostimulatory nucleic acid is 6 to 100 nucleotides in length. In other embodiments, the length is 8-35. Preferably, the size of the TG oligonucleotides is between 15 and 25 nucleotides.
[114] The size of the immunostimulatory nucleic acid (ie, the number of nucleotide residues along the length of the nucleic acid) can also contribute to the stimulatory activity of this nucleic acid. The inventors have found that even in the case of immunostimulatory nucleic acids with high immunostimulatory properties, the length of the nucleic acid influences the degree of immunostimulation that can be achieved. Increasing the length of the T-rich nucleic acid up to 24 nucleotides proved to increase immunostimulation. The experiments described in the Examples demonstrate that when the length of T-rich nucleic acids is increased by 18 to 27 nucleotides, the ability of the nucleic acid to stimulate an immune response is significantly increased (ODN decreasing in size from 27 to 18 nucleotides). # 2194, 2183, 2195 and 2196). Increasing the length of the nucleic acid by up to 30 nucleotides strongly influences the biological properties of the nucleic acid, but increasing the length of the nucleic acid by more than 30 nucleotides did not seem to affect the immunostimulatory effect anymore. (For example, compare ODN 2179 and ODN 2006).
[115] TG nucleic acids that are 15-25 nucleotides in length have been shown to be able to exhibit increased immunostimulation. Thus, in one aspect, the invention is 15-27 nucleotides in length (ie, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides in length). Oligonucleotides) which may be T-rich nucleic acids or TG nucleic acids or both T-rich and TG nucleic acids. In one embodiment, the oligonucleotide is neither a T-rich nucleic acid nor a TG nucleic acid. In other embodiments, the oligonucleotides do not have a CG motif. Similarly, the present invention provides oligonucleotides 15-27 nucleotides in length, oligonucleotides 18-25 nucleotides in length, oligonucleotides 20-23 nucleotides in length, oligonucleotides 23-25 nucleotides in length to provide. Any of the above embodiments regarding oligonucleotides of 15-27 nucleotides in length also relates to oligonucleotides of these various lengths. In addition, the present invention includes the use of any of these oligonucleotides in the methods described herein.
[116] Shorter or longer, even if maximum levels of immunostimulation are obtained when using some T-rich nucleic acids with a length of 24-30 nucleotide residues, as well as some TG nucleic acids with lengths of 15 to 25 nucleotides Immunostimulatory nucleic acids can also be used in accordance with the methods of the present invention. In order for the immunostimulatory nucleic acid to be easily introduced into the cell, the maximum length of the nucleic acid is preferably 6 nucleotide residues. Nucleic acid of any size exceeding six nucleotides (even a few kb in length) can induce an immune response in accordance with the present invention when sufficient immunostimulatory motifs are present, which results in larger nucleic acids being degraded in the cell. Because. Preferably, the immunostimulatory nucleic acid is 8 to 100 nucleotides in length, in some embodiments the T-rich containing immunostimulatory nucleic acid is 24 to 40 nucleotides in length, and the TG containing immunostimulatory nucleic acid is 15 to 25 nucleotides in length. Nucleotides.
[117] In one embodiment, the T-rich nucleic acid is represented by at least the formula 5'X ₁ X ₂ TTTTX ₃ X ₄ 3 '. Wherein X ₁ , X ₂ , X ₃ and X ₄ are nucleotides. In one embodiment, X ₁ X ₂ is TT and / or X ₃ X ₄ is TT. In another embodiment, X ₁ X ₂ is any one of nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA and GC; X ₃ X ₄ is any one of nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA and GC.
[118] In some embodiments, it is preferred that the immunostimulatory nucleic acid does not contain poly-C (CCCC) or poly-A (AAAA). In other embodiments, the immunostimulatory nucleic acid preferably comprises poly-C, poly-A, poly-G (GGGG) or multiple GGs. In particular, poly-G or multi-GG motifs show significant efficacy against some immunostimulatory nucleic acids. The effect of these non-T sequences depends in part on the state of the nucleic acid backbone. For example, if the nucleic acid has a phosphodiester backbone or chimeric backbone, the inclusion of these sequences in the nucleic acid will give only minimal effect to the biological activity of the nucleic acid. If the backbone is completely phosphorothioate (or other phosphate variant) or notably phosphorothioate, the inclusion of these sequences has a greater effect on the biological activity or the rate of reaction of the biological activity, resulting in T-rich and TG immunostimulatory nucleic acids. Can reduce the effect.
[119] Although C-rich nucleic acids have been demonstrated to be immunostimulatory, the insertion of poly-C sequences into T-rich nucleic acids in a way that reduces the relative proportion of T nucleotides in the nucleic acids can negatively affect the nucleic acids. Applicants are independent of the proposed mechanism, but the immune system develops a mechanism for distinguishing nucleic acids with different nucleotide properties, so that different sets of binding proteins that recognize different sequences, or specific bindings that recognize all immunostimulatory sequences with different affinity. It is thought to produce a protein. In general, the immunostimulatory properties of nucleic acids comprising unmethylated CpG motifs are the strongest, followed by the immunostimulatory properties of T-rich nucleic acids, TG nucleic acids and C-rich nucleic acids. However, this generalization has many exceptions. For example, strong T-rich nucleic acids, such as SEQ ID NO: 886, have stronger immunostimulatory properties in some assays than some CpG containing nucleic acids (eg, phosphorothioate CpG nucleic acids containing a single CpG motif).
[120] It has also been found that poly-A tails can be added to immunostimulatory nucleic acids to elevate their activity. It was found that when the poly-A tail (AAAAAA) or poly-T tail (TTTTTT) was added to modify the highly immunostimulatory CpG nucleic acid (SEQ ID NO: 246), the immunostimulatory activity of the resulting oligonucleotides was increased. The ability of poly-A tails and poly-T tails to increase the immunostimulatory properties of oligonucleotides was very similar. SEQ ID NO: 246 is a T-rich oligonucleotide. When poly-A and poly-T tails are added to nucleic acids that are not rich in T, it seems to have a greater impact on the immunostimulatory properties of the nucleic acids. Because poly-T tails are added to very T-rich nucleic acids, the immunostimulatory properties of poly-T additions are somewhat, if not entirely, weakened. This finding has important implications for the use of the poly-A region. Thus, in some embodiments, an immunostimulatory nucleic acid comprises a poly-A region, in other embodiments it is not.
[121] Some of the immunostimulatory nucleic acids of the invention comprise one or more CG motifs. The presence of CG motifs in immunostimulatory nucleic acids also affects the biological activity of the nucleic acids. When the total length of immunostimulatory nucleic acids is 20 nucleotide residues or less, CpG motifs are important for determining the immune effects of nucleic acids, and methylation of these motifs reduces the immunostimulatory effects of nucleic acids. If the length of the immunostimulatory nucleic acid is increased to 24 nucleotides, the immunostimulatory effect of the nucleic acid is less dependent on the CpG motif and is no longer eliminated by methylation of the CpG motif or their conversion to GC dinucleotides, provided that There are other immunostimulatory properties described herein.
[122] For example, ODN 2006 (SEQ ID NO: 246) is a T-rich nucleic acid having four CpG dinucleotides, 24 nucleotide residues in length, and high immunostimulatory properties. However, the immunostimulatory properties of ODN 2117 (SEQ ID NO: 358) in which the CpG motif is methylated are also high. The CpG motif of ODN 2006 is converted to GpC so that ODN 2137 (SEQ ID NO: 886) with six TG dinucleotides also exhibits immunostimulatory properties. The immunostimulatory effects of nucleic acids such as ODN 2117 and 2137 are controlled by their T and TG content. Each of these three nucleic acids is rich in T, and ODN 2137 is also rich in T. If their T content is reduced by inserting another base such as A (ODN 2117 (SEQ ID NO: 358)), or if their TG content is reduced by substituting TG with AG, the immunostimulatory effect is somewhat reduced. In another example, a 24 nucleotide long nucleic acid with all positions randomized has only moderate immunostimulatory effects (ODN 2182; SEQ ID NO: 432). Twenty-four nucleotide-long nucleic acids with different nucleotide compositions have different immunostimulatory effects depending on their T content [ODN 2188 (SEQ ID NO: 905), 2189 (SEQ ID NO: 906), 2190 (SEQ ID NO: 907), 2191 (SEQ ID NO: 908), 2193 (SEQ ID NO: 910), 2183 (SEQ ID NO: 433) and 2178 (SEQ ID NO: 428). ODN 2190 containing the TGT motif has stronger immunostimulatory properties than ODN 2202 with the TGG motif. Thus, in some embodiments a TGT motif is preferred. In other embodiments, the number of TG motifs is important in that immunostimulation is increased with increasing number of TG motifs. Some preferred TG nucleic acids contain three or more TG motifs.
[123] Examples of CpG nucleic acids include the nucleic acids set forth in Table A, such as SEQ ID NOs: 1, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286-287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648- 650, 653-664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 81 7, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904 and 909-913 It is not limited.
[124] In some embodiments of the invention, the immunostimulatory nucleic acid comprises CpG dinucleotides, and in other embodiments the immunostimulatory nucleic acid does not comprise CpG dinucleotides. CpG dinucleotides may or may not be methylated. Nucleic acids containing one or more unmethylated CpG dinucleotides contain unmethylated cytosine-guanine dinucleotide sequences (ie, "CpG DNA", or unmethylated 5 'cytosine followed by 3' guanosine and are linked by phosphate bonds Nucleic acid molecules containing DNA) and activate the immune system. A nucleic acid containing at least one unmethylated CpG dinucleotide is a nucleic acid containing a methylated cytosine-guanine dinucleotide sequence (ie, containing methylated 5 'cytosine followed by 3' guanosine and linked by phosphate bonds). .
[125] Examples of T-rich nucleic acids that do not contain CpG nucleic acids include those listed in Table A, such as SEQ ID NOs: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342 , 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886 , 905, 907, 908, and 910-913. Examples of T-rich nucleic acids, including CpG nucleic acids, include the nucleic acids set forth in Table A, such as SEQ ID NOs: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891.
[126] Immunostimulatory nucleic acids may be double-stranded or single-stranded. In general, double-stranded molecules are more stable than in vivo, but single-stranded molecules have increased immune activity. Thus, in some aspects of the invention it is preferred that the nucleic acid is single stranded, and in other aspects it is preferred that the nucleic acid is double stranded.
[127] As used herein, the terms T-rich nucleic acid and TG nucleic acid refer to immunostimulatory T-rich nucleic acid and immunostimulatory TG nucleic acid, respectively, unless otherwise specified. The T-rich nucleic acid sequences of the invention are broadly described in Table A, as well as the above-described nucleic acids, as well as having one or more poly T motifs and / or having a composition in which the T nucleotide residue is greater than 25% or preferably 35%. Nucleic acid. C-rich nucleic acids are nucleic acids having one or more, preferably two or more poly-C regions. The TG nucleic acids of the invention are broadly the specific nucleic acids set forth in Table A, as well as the nucleic acids described above, with one or more TG motifs.
[128] The nucleic acid of the present invention is not essential but may also comprise a poly G motif. Poly G-containing nucleic acids also exhibit immunostimulatory properties. Pisetsky and reich, 1993 Mol. Biol. Reports, 18: 217-221; Krieger and Herz, 1994, Ann. Rev. Biochem., 63: 601-637; Macaya et al., 1993, PNAS, 90: 3745 -3749; Wyatt et al., 1994, PNAS, 91: 1356-1360; Rando and Hogan, 1998, In Applied Antisense Oligonucleotide Technology, ed.Krieg and Stein, p. 335-352; and Kimura et al., 1994, J. Biochem. 116, 991-994 also discloses immunostimulatory properties of poly G nucleic acids.
[129] The poly G nucleic acid is preferably a nucleic acid having the formula 5'X ₁ X ₂ GGGX ₃ X ₄ 3 '. Wherein X ₁ , X ₂ , X ₃ and X ₄ are nucleotides. In a preferred embodiment, at least one of X ₃ and X ₄ is G. In other embodiments, both X ₃ and X ₄ are G. In other embodiments, the preferred formula is 5'GGGNGGG3 'or 5'GGGNGGGNGGG3', where N represents 0-20 nucleotides. In other embodiments, the poly G nucleic acid is a nucleic acid that does not comprise an unmethylated CG dinucleotide, eg, SEQ ID NOs: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, Nucleic acids described as 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936 and 938. In other embodiments, the poly G nucleic acid is a nucleic acid comprising one or more unmethylated CG dinucleotides, such as SEQ ID NOs: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264 , 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876 , 892, 909, 926, 927, 932 and 937.
[130] The terms “nucleic acid” and “oligonucleotide” refer to phosphate groups and exchangeable organic bases [substituted pyrimidines (eg, cytosine (C), thymidine (T) or uracil (U)) or substituted purines (eg Eg, adenine (A) or guanine (G)), meaning a plurality of nucleotides (ie, a molecule comprising a sugar (eg, ribose or deoxyribose)). do. As used herein, the term refers to oligoribonucleotides as well as oligodeoxyribonucleotides. The term also includes polynucleosides (ie, phosphate free polynucleotides) and any other organic acid containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (eg, genome or cDNA), but are preferably synthesized (eg, produced by nucleic acid synthesis).
[131] The terms nucleic acid and oligonucleotide also include, for example, base and / or sugar substituted or modified nucleic acids or oligonucleotides. For example, these include nucleic acids in which the backbone sugar is covalently attached to low molecular weight organic groups other than hydroxyl groups at the 3 'position and phosphate groups at the 5' position. Thus, the modified nucleic acid may comprise a 2'-0-alkylated ribose group. The modified nucleic acid may also include sugars such as arabinose instead of ribose. Thus, nucleic acids can be heterogeneous in the backbone composition, so that the polymer units can contain any possible polymer combination, such as a peptide-nucleic acid (having an amino acid backbone with a nucleic acid base), linked to each other. In some embodiments, the nucleic acid is homogeneous in the backbone composition. Nucleic acids also include substituted purines and pyrimidines, such as C-5 propine modified bases (Wagner et al., Nature Biotechnology 14: 840-844, 1996). Purines and pyrimidines include adenine, cytosine, guanine, thymidine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hipoxanthin, other naturally occurring and non- Naturally occurring nucleobases, substituted aromatic moieties and unsubstituted aromatic moieties include, but are not limited to.
[132] For use in the present invention, the nucleic acids of the present invention may be used in any of a number of methods known in the art, such as the b-cyanoethyl phosphoramidite method (Beaucage, SL, and Caruthers, MH, Tet). Let. 22: 1859, 1981); Nucleoside H-phosphonate method (Garegg et al., Tet. Let. 27: 4051-4054, 1986; Froehler et al., Nucl. Acid.Res. 14: 5399-5407, 1986; Garegg et al. , Tet. Let. 27: 4055-4058, 1986; Gaffney et al., Tet. Let. 29: 2619-2622, 1988). These chemical synthesis can be performed by a variety of commercially available automated nucleic acid synthesizers. These nucleic acids are called synthetic nucleic acids. Alternatively, T-rich and / or TG dinucleotides in the plasmid can be prepared on a large scale (Sambrook, T., et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor laboratory Press, New York) , 1989), which can be separated into smaller pieces or administered entirely. Nucleic acids can be prepared from existing nucleic acid sequences (eg, genome or cDNA) using known techniques such as techniques using restriction enzymes, exonucleases or endonucleases. Nucleic acids produced in this manner are called isolated nucleic acids. Isolated nucleic acid generally refers to a nucleic acid isolated from components normally bound to the nucleic acid in its natural state. For example, an isolated nucleic acid can be a nucleic acid isolated from a cell, nucleus, mitochondria or chromosome. The terms Py-rich nucleic acid and TG nucleic acid include both synthetic and isolated Py-rich nucleic acids and TG nucleic acid.
[133] For in vivo use, Py-rich and TG nucleic acids can optionally be relatively resistant to degradation (eg, stabilized). "Stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to degradation in vivo (eg, degradation via exonuclease or endonuclease). Stabilization can be a function of length or secondary structure. Nucleic acids as long as tens to hundreds of kb are relatively resistant to degradation in vivo. For shorter nucleic acids, secondary structures can be stabilized to increase their effect. For example, if the 3 'end of the nucleic acid has self-complementarity to the upstream region and can be folded upside down to form a kind of stem loop structure, the nucleic acid is stabilized and exhibits higher activity.
[134] Alternatively, stabilization of the nucleic acid can be achieved through phosphate backbone modification. Preferred stabilizing nucleic acids of the invention have a modified backbone. Modifications of the nucleic acid backbone have been demonstrated to provide elevated activity of Py-rich and TG nucleic acids when administered in vivo. These stabilizing structures are preferred because the Py-rich and TG molecules of the present invention have at least a partially modified backbone. Py-rich and TG constructs with phosphorothioate bonds provide maximal activity and protect nucleic acids from degradation by intracellular exonucleases and endonucleases. Other modified nucleic acids include phosphodiester modified nucleic acids, combination nucleic acids of phosphodiester modified nucleic acids and phosphorothioate modified nucleic acids, methylphosphonate modified nucleic acids, methylphosphothioate modified nucleic acids, phosphorodithioate modified nucleic acids, p-ethoxy modified nucleic acids and combination nucleic acids thereof. Each of these combination nucleic acids, and their specific effects on immune cells, are described in PCT published patent applications PCT / US95 / 01570 (WO 96/02555) and PCT / US97 / 19791 (WO 98/18810) [February 7, 1995, respectively. And US Patent Application Nos. 08 / 386,063 and 08 / 960,774, filed Oct. 30, 1997, are described in more detail with respect to CpG nucleic acids, the preambles of which are described herein. It shall be included in. It is contemplated that these modified nucleic acids may exhibit higher stimulatory activity due to elevated resistance to nucleases, increased cellular uptake, increased protein binding and / or altered intracellular localization.
[135] The composition of the present invention may optionally be a chimeric oligonucleotide. Chimeric oligonucleotides are oligonucleotides having the formula 5'Y ₁ N ₁ ZN ₂ Y ₂ 3 '. Y ₁ and Y ₂ are nucleic acid molecules having 1 to 10 nucleotides. Each of Y ₁ and Y ₂ comprises one or more modified internucleotide bonds. Since two or more nucleotides of the chimeric oligonucleotides comprise a backbone modification, these nucleic acids are an example of a kind of "stabilized immunostimulatory nucleic acid."
[136] With regard to chimeric oligonucleotides, Y ₁ and Y ₂ are considered to be independent of each other. This means that each of Y ₁ and Y ₂ may or may not have different sequences and different backbone bonds in the same molecule. The sequences vary, but in some cases Y ₁ and Y ₂ have poly-G sequences. A poly-G sequence refers to three or more G's in a line. In other embodiments, a poly-G sequence refers to 4, 5, 6, 7, or 8 or more Gs arranged in series. In other embodiments, Y ₁ and Y ₂ may be TCGTCG, TCGTCGT or TCGTCGTT (SEQ ID NO: 1145). In addition, Y ₁ and Y ₂ may have a poly-C, poly-T or poly-A sequence. In some embodiments, Y ₁ and / or Y ₂ have 3 to 8 nucleotides.
[137] N ₁ and N ₂ are nucleic acid molecules having 0 to 5 nucleotides as long as N ₁ ZN ₂ has a total of at least 6 nucleotides. Nucleotides of N ₁ ZN ₂ have a phosphodiester backbone and do not include nucleic acids having a modified backbone.
[138] Z is an immunostimulatory nucleic acid but does not contain CG. For example, Z may be a nucleic acid T-rich sequence, eg, comprising a TTTT motif, or a sequence in which at least 50% of the sequence base is T, or Z may be a TG sequence.
[139] The central nucleotides of the formula Y ₁ N ₁ ZN ₂ Y ₂ (N ₁ ZN ₂ ) have phosphodiester internucleotide bonds, Y ₁ and Y ₂ have at least one modified internucleotide bond, but one or more or even all modifications It may also have an internucleotide bond. In a preferred embodiment, Y ₁ and / or Y ₂ have at least two or two to five modified nucleotide bonds, or Y ₁ has two modified internucleotide bonds and Y ₂ has five modified internucleotides Have a bond, or Y ₁ has five modified internucleotide bonds and Y ₂ has two modified internucleotide bonds. In some embodiments, the modified internucleotide bond is a phosphorothioate modified bond, a phosphorodithioate modified bond or a p-ethoxy modified bond.
[140] Modified backbones, such as phosphorothioate, can be synthesized using automated techniques using phosphoramidate or H-phosphonate chemicals. Aryl- and alkyl-phosphonates can be prepared, for example, as described in US Pat. No. 4,469,863; Alkylphosphotriesters (the charged oxygen balance is alkylated as described in US Pat. No. 5,023,243 and EP 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone variants and substituents are described in Uhlmann, E. and Peyman, A., Chem. Rev. 90: 544, 1990; Goodchild, J., Bioconjugate Chem. 1: 165, 1990. have.
[141] Other stabilizing nucleic acids include nonionic DNA homologues such as alkyl- and aryl-phosphates (filled phosphonate oxygen is replaced with alkyl or aryl groups), phosphodiesters and alkylphosphotriesters (filled oxygen moieties are alkylated). Included. Nucleic acids containing diols, such as tetraethyleneglycol or hexaethyleneglycol at one or both ends, are also substantially resistant to nuclease degradation.
[142] When a Py-rich or TG nucleic acid is administered with an antigen encoded in a nucleic acid vector, the backbone of the Py-rich or TG nucleic acid is preferably a chimeric combination of phosphodiester and phosphorothioate (or other phosphate variant). . Cells may have the problem of accepting plasmid vectors in the presence of complete phosphorothioate nucleic acids. Thus, when the vector and nucleic acid are delivered to a subject, the nucleic acid preferably has a chimeric backbone or a phosphorothioate backbone, but it is desirable that the plasmid and vehicle that deliver the plasmid directly into the cell are combined to eliminate the need for cellular uptake. Do. Such vehicles are known in the art and include, for example, liposomes and gene guns.
[143] Numerous control nucleic acids as well as the nucleic acids described herein are set forth in Table A below.
[144] TABLE 1
[145]
[146]
[147]
[148]
[149]
[150]
[151]
[152]
[153]
[154]
[155]
[156]
[157]
[158]
[159]
[160]
[161]
[162]
[163]
[164]
[165]
[166]
[167]
[168] Although the characteristics of the CpG effect in mice are well characterized, information on human systems is limited. CpG phosphorothioate oligonucleotides that show strong stimulatory activity in mouse systems show lower activity against human and other non-rodent immune cells. The development of potent human CpG motifs, and their effects on human primary B-cells and the characterization of the mechanism of action are described in the Examples. DNA containing this CpG motif strongly stimulated human primary B-cells to proliferate, produce IL-6 and express increased levels of CD86, CD40, CD54 and MHC II. The DNA increased not only the DNA binding activity of the transcription factors NFκB and AP-1, but also the phosphorylation of stress-activated protein kinases JNK and p38 and transcription factor ATF-2. The B-cell signaling pathway activated by CpG DNA was different from the pathway activated by B-cell receptors that activate JNK of ERK and various isoforms but not p38 and ATF-2. In general, data on CpG DNA-initiated signal transduction was consistent with that obtained in mice (Hacker H., et al., 1998, Embo J. 17: 6230, Yi AK, and Krieg AM 1998, J. Immunol. 161 : 4493).
[169] Preferred non-rodent motifs are 5'TCGTCGTT3 '. Base exchange in the most potent 8 mer CpG motif (5'TCGTCGTT3 ') reduced the activity of the oligonucleotides. The thymidine at the 5 'and 3' positions of this motif was more important than the thymidine at the intermediate position. Adenine or guanosine in the intermediate position reduced the activity of the oligonucleotides.
[170] Of course, our study demonstrates that one human CpG motif in phosphodiester oligonucleotide 2080 is sufficient to achieve maximum effect and that the additional CpG motif 2059 does not elevate further activity. Oligonucleotides with an 8-mer motif 5'TCG TCG TT3 '(2080) containing two CpG dinucleotides showed the highest activity in this study. Replacement of bases (5 'position, intermediate position, 3' position) flanking both CpG dinucleotides reduced the activity of this sequence. Two CpG dinucleotides within the 8-mer CpG motif were required for optimal activity (2108, 2106). Cytidine methylation of CpG dinucleotide (2095) lost the activity of 2080, but unrelated cytidine (2094) methylation did not lose the activity of 2080. The 2059 obtained by incorporating two CpG motifs within the 2080 sequence did not further increase the activity of the phosphodiester oligonucleotides. The 2080 sequence with phosphorothioate backbone (2116) showed weaker activity, suggesting that additional CpG motifs are preferred for effective phosphorothioate oligonucleotides.
[171] In accordance with the present invention, immunostimulatory nucleic acids have been found to have potent immunostimulatory effects on human cells such as NK cells, B cells and DCs in vitro. In vitro assays used herein suggested in vivo efficacy as a vaccine adjuvant in non-rodent vertebrates (Example 12), in which immunostimulatory nucleic acid was used for human vaccination, cancer immunotherapy, asthma immunotherapy, general function of immune function. It has been demonstrated to be an effective therapeutic for strengthening, enhancing hematopoietic recovery after radiotherapy or chemotherapy, and other immunomodulatory uses.
[172] Thus, immunostimulatory nucleic acids may be used for prophylaxis for the treatment of infections with infectious organisms, cancers for which certain cancer antigens have been identified, or subjects at risk for developing allergies or asthma known for predisposition to allergens or asthma. It is useful in some aspects of the invention as a vaccine. Immunostimulatory nucleic acids may be administered without antigen or allergens for infection, allergy or cancer for a shorter period of time, where repeated administration will provide protection against infection, allergy or cancer for a longer period of time. As used herein, a subject at risk for infection, allergy or cancer is a subject at risk of exposure to a pathogen, cancer, allergen causing the infection, or at risk of developing cancer. For example, a subject at risk is a subject planning to travel to an area where a particular type of infectious agent is found, or is exposed to or infected with a body fluid that may contain an infectious organism through lifestyle or medical treatment. Direct subjects, or even any subjects living in areas where infectious organisms or allergens have been identified. Subjects at risk of infection also include a general population who is recommended to be vaccinated with a particular infectious organism antigen from a medical institution. If the antigen is an allergen and the subject develops an allergic reaction to a particular antigen and the subject can be exposed to the antigen, ie, for a few seasons, the subject is at risk of exposure to the antigen. Subjects at risk of developing allergies or asthma are at risk of developing these diseases due to genetic or environmental factors, as well as subjects who have allergies or asthma but are found to have no active disease during immunostimulatory nucleic acid treatment. Subjects to be considered are included.
[173] Subjects at risk of developing cancer are those who are more likely to develop cancer. These subjects include, for example, subjects with genetic defects that have been demonstrated to correlate with a high likelihood of developing cancer; And subjects exposed to cancer-causing agents such as tobacco, asbestos, or other chemical toxins, or subjects who have previously been treated for cancer and have apparent remission. If a subject at risk of developing cancer is treated with antigens and immunostimulatory nucleic acids specific for the type of cancer at risk of developing in the subject, the subject may kill the cancer cells that develop. Once the tumor begins to form in the subject, the subject will elicit a specific immune response against the tumor antigen.
[174] In addition to the use of immunostimulatory nucleic acids for prophylactic treatment, the present invention also encompasses the use of immunostimulatory nucleic acids for the treatment of a subject suffering from infection, allergy, asthma or cancer.
[175] Subjects with infections are subjects that are exposed to infectious pathogens and have detectable levels of acute or chronic pathogens in their bodies. Immunostimulatory nucleic acids can be used with antibodies to elicit antigen specific systemic or mucosal immune responses at levels that can reduce or eradicate infectious pathogens. As used herein, an infectious disease is a disease caused by the presence of an external microorganism in the body. In particular, it is important to develop effective vaccination and treatment methods for protecting the mucosal surface of the body, the primary site through which pathogens invade.
[176] Subjects with allergies are subjects who are or are at risk of developing an allergic reaction in response to allergens. Allergy refers to acquired hypersensitivity to a substance (allergen). Allergic symptoms include, but are not limited to, eczema, allergic rheumatism or nasal congestion, high fever, conjunctivitis, bronchial asthma, gallbladder (pelp) and food allergies, and other atopic symptoms.
[177] Currently, allergic diseases are generally treated by injecting a small amount of antigen followed by injection of the antigen with increasing dosage. This method is thought to induce resistance to allergens and prevent further allergic reactions. However, these methods can take several years to be effective and are associated with the risk of side effects such as anaphylactic shock. The method of the present invention does not have this problem.
[178] Allergies are generally caused by the production of IgE antibodies against allergens that are not harmful. Cytokines induced by systemic or mucosal administration of immunostimulatory nucleic acids are primarily of the class called Th1 (for example with IL-12 and IFN-γ), which induce both humoral and cellular immune responses. Antibodies of the type associated with Th1 responses generally have higher protection because they have high neutralizing and opsonizing ability. Another major form of immune response associated with the production of IL-4, IL-5 and IL-10 cytokines is called Th2 immune response. Th2 responses mainly involve antibodies, which have a weaker protective effect against infection and some Th2 isotypes (eg IgE) are associated with allergies. In general, allergic diseases are mediated by Th2 type immune responses, but Th1 responses provide maximum protection against infection even if excessive Th1 responses are associated with autoimmune diseases. To treat an allergy based on the ability of an immunostimulatory nucleic acid to convert an immune response from a Th2 response (which is associated with the production of IgE antibodies and allergies) to a Th1 response (which has a protective effect on allergic responses) in a subject A subject to be prevented can be administered a dosage effective to induce an immune response of an immunostimulatory nucleic acid.
[179] Thus, immunostimulatory nucleic acids are quite useful for the treatment of allergic symptoms and non-allergic symptoms such as asthma. Th2 cytokines, particularly IL-4 and IL-5, are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotope switching, eosinophil chemotaxis and activation, and growth of mast cells. Th1 cytokines, in particular IFN-γ and IL-12, can inhibit the formation of Th2 clones and the production of Th2 cytokines. Asthma refers to respiratory system disorders characterized by inflammation, narrowing of the airways, and increased reactivity of the airways to inhaled material. Asthma is a common disease, although not entirely associated with atopic or allergic symptoms.
[180] Subjects with cancer are subjects with detectable cancer cells. The cancer may be malignant or non-malignant. Cancers or tumors include biliary tract cancer; Brain cancer; Breast cancer; Uterine cancer; Chorionic cancer; Colon cancer; Endometrial cancer; Esophageal cancer; Stomach cancer; Epithelial sarcoma; Lymphoma; Liver cancer; Lung cancer (eg small cell and non-small cell); Melanoma; Neuroblastoma; Oral cancer; Ovarian cancer; Pancreatic cancer; Prostate cancer; Rectal cancer; sarcoma; cutaneous cancer; Testicular cancer; Thyroid cancer; And renal cancers, as well as other carcinomas and sarcomas. In one embodiment, the cancer is hairy cell leukemia, chronic myeloid leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma or colon carcinoma .
[181] Subjects according to the invention are non-rodent subjects. Non-rodent subjects include, but are not limited to, dogs, cats, horses, cows, pigs, sheep, goats, chickens, primates, such as monkeys, and fish (aquaculture species), such as salmon Specifically, it refers to humans and vertebrates except rodents such as mice and mice.
[182] Thus, the present invention can also be used to treat cancer and tumors in non-human subjects. Cancer is one of the leading causes of death of pets (ie cats and dogs). In home-grown pets, the older animals that make up the family usually develop cancer. 45% of dogs over 10 years seem to die of cancer. The most common treatments include surgery, chemotherapy and radiotherapy. Other treatments that have been used with a certain degree of success are laser therapy, cryotherapy, thermotherapy and immunotherapy. The choice of treatment method depends on the type of cancer and the degree of metastasis. If malignant growth is not limited to a specific site in the body, it is difficult to remove only malignant tissue without affecting normal cells.
[183] Malignant diseases commonly diagnosed in dogs and cats include lymphomas, osteosarcomas, breast tumors, blastocysts, brain tumors, melanomas, adenosquamous carcinomas, carcinoid lung tumors, bronchial gland tumors, bronchial adenocarcinomas, fibromas, mycochondromas, lung sarcomas , But not limited to, neurosarcoma, osteosarcoma, papilloma, retinoblastoma, Ebbings tumor, Wilms' tumor, Burkitt's lymphoma, microglia, neuroblastoma, osteoclast, oral tumor, fibrosarcoma, osteosarcoma and rhabdomyosarcoma . Other tumors in dogs include genital squamous cell carcinoma, hereditary genital tumor, testicular tumor, normal carcinoma, Sertoli cell tumor, pericarcinoma, histiocytoma, green carcinoma (granulosarcoma), corneal papilloma, corneal squamous cell carcinoma, angiosarcoma, pleura Mesothelioma, basal cell tumor, thymoma, gastric tumor, adrenal carcinoma, oral papilloma, hemangioendothelioma and cyst adenoma. Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphsarcoma, fibrosarcoma, and lung small cell carcinoma. In even more popular pets, ferrets are known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and gastric adenocarcinoma.
[184] Tumors affecting agricultural livestock include leukemia, pericarcinoma and bovine ocular tumors (occurring in cattle); Foreskin fibrosarcoma, ulcerative squamous cell carcinoma, foreskin carcinoma, connective tissue tumor and non-blastoma (occurring in horse); Hepatocellular carcinoma (occurs in pigs); Lymphoma and pulmonary adenosis (occurs in sheep); Pulmonary sarcoma, lymphoma, Raus sarcoma, retinal endothelial cellosis, fibrosarcoma, neoblastoma, B-cell lymphoma and lymphocytic leukemia (occurring in algae); Retinoblastoma, hepatosarcoma, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and lei sarcoma (occurring in fish), cheese-like lymphadenitis (CLA); Chronic, infectious, infectious diseases of sheep and goats caused by bacterium corynebacterium tuberculosis; And positive infectious lung tumors, caused by jaagsiekte.
[185] The subject is exposed to the antigen. As used herein, the term “exposed” refers to the active step of contacting a subject with an antigen or the passive exposure of the subject to an antigen in vivo. Methods of actively exposing a subject to an antigen are known in the art. Generally, the antigen is administered directly to the subject by any method, such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. The antigen can be administered systemically or topically. Methods of administering antigens and immunostimulatory nucleic acids are described in more detail below. The subject is passively exposed to the antigen once the antigen can be exposed to immune cells in the body. The subject may be passively exposed to the antigen, for example, by introducing an external pathogen into the body or generating tumor cells that express an external antigen on the surface.
[186] The method of passively exposing a subject to an antigen may depend, in particular, on the timing of administration of the immunostimulatory nucleic acid. For example, in subjects at risk of developing cancer, infectious diseases, allergic reactions or asthma reactions, immunostimulatory nucleic acids are present at the highest risk, i.e. during allergic periods or regularly after subjects are exposed to cancer-causing agents. Can be administered. In addition, immunostimulatory nucleic acids can be administered to a traveler before traveling to an outside area where the traveler is at risk of exposure to infectious material. Likewise, immunostimulatory nucleic acids can be administered to soldiers or citizens who are at risk of exposure to the bacterial warfare to induce a systemic or mucosal immune response to the antigen when the soldier or citizen is exposed to bacterial warfare.
[187] As used herein, antigens are molecules that can elicit an immune response. Antigens include cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptides, non-peptide analogs of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses, viral extracts, And multicellular organisms such as parasites and allergens. The term antigen broadly includes any type of molecule that is recognized as a foreign substance by the host immune system. Antigens include, but are not limited to, cancer antigens, microbial antigens and allergens.
[188] As used herein, a cancer antigen is a compound, such as a peptide or protein, that is bound to a tumor or cancer cell surface and capable of generating an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens can be prepared, for example, by preparation of crude extracts of cancer cells, partial purification of antigens, recombinant techniques or de novo of known antigens, as described, for example, in Cohen, et al., 1994, Cancer Research, 54: 1055. It can be produced from cancer cells by synthesis. Cancer antigens include, but are not limited to, antigens expressed by recombinant technology, immunogenic regions of antigens, or tumors or cancer as a whole. Such antigens may be isolated or prepared by recombinant methods or any other method known in the art.
[189] As used herein, microbial antigens are antigens of microorganisms and include, but are not limited to, viruses, bacteria, parasites and fungi. Such antigens include not only intact microorganisms, but also natural compounds and fragments or derivatives thereof, and synthetic compounds which are the same or similar to natural microbial antigens and elicit an immune response specific for that microorganism. When a compound induces an immune response (humidity and / or cellular) to a natural microbial antigen, the compound is similar to a natural microbial antigen. Such antigens are commonly used in the art and are well known to those of ordinary skill in the art.
[190] Examples of viruses found in humans include human immunodeficiency virus such as Retroviridae (eg, HIV-1 (also called HTLV-III, LAV, HTLV-III / LAV, or HIV-III); and HIV- Other isolates such as LP); Picornaviridae (eg, polio virus, hepatitis A virus; enterovirus, human coxsackie virus, rhinoviruse , echoviruse ); Calciviridae (eg, strains causing gastroenteritis); Togavirida e (eg, encephalitis virus, rubella virus); Flaviridae (eg, dengue virus, encephalitis virus, yellow fever virus); Coronoviridae (eg, coronaviruses); Rhabdoviradae (eg bullous stomatitis virus, rabies virus); Coronaviridae (eg, coronaviruses); Rhabdoviradae (eg bullous stomatitis virus, rabies virus); Filoviridae (eg, Ebola virus); Paramyxoviridae (eg, parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (eg, influenza virus); Beongga against corruption (Bungaviridae) (e.g., Hantaan virus, beongga virus, play beam virus (phleboviruse) and virus at the age); Arena viridae (hemorrhagic fever virus); Reoviridae (eg, leoviruses, orbiviruses and rotaviruses); Birnaviridae ; Hepadnaviridae (hepatitis B virus); Parvoviridae (parvovirus); Papovaviridae (Papiloma virus, Polyoma virus); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus); Poxviridae ( natural head virus, vaccinia virus, pox virus); And lridoviridae (eg, African swine fever virus); And unclassified viruses [eg, pathogens of cavernous encephalopathy, pathogens of delta hepatitis (presumed to be satellite deficient in hepatitis B virus), pathogens of non-A, non-B hepatitis (class 1 = internally delivered; class 2 = parenterally delivered (ie, hepatitis C); Norwalk and related viruses, and astroviruses].
[191] Both gram negative and gram positive bacteria act as antigens in vertebrates. Such Gram-positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species. Gram negative bacteria include, but Escherichia coli (Escherichia coli), Pseudomonas species (Pseudomonas species) and Salmonella species (Salmonella species), but is not limited thereto. Specific examples of infectious bacteria include Helicobacter pyloris , Borelia burgdorferi , Legionella pneumophilia , Mycobacteria species (e.g., Mycobacteria tuberculosis ( M) tuberculosis ), mycobacterial Avium ( M. avium ), mycobacteria intracellulare ( M. intracellulare ), mycobacteria Kansai ( M. kansaii ), mycobacteria Gordonae ( M. gordonae ) ( Staphylococcus aureus ), Neisseria gonorrhoeae , Neisseria meningitidis , Listeria monocytogenes, Streptococcus pyogenes (Group A streptococcus), Streptococcus Agar lock thiazole (Streptococcus agalactiae) (group B Streptococcus Scotland), Streptococcus (irregularities thiooxidans group), Streptococcus faecalis (Streptococcus faecalis), streptococcus Vorbis (Streptococcus bovis), Streptococcus (anaerobic species), Streptococcus pneumoniae (Streptococcus pneumoniae) , pathogenic Campylobacter species (Campylobacter sp.), Enterococcus nose kusu species (Enterococcus sp.), by a brush loose influenza (Haemophilus influenzae), Bacillus anthraquinone system (Bacillus antraci s), Corynebacterium diphtheria (corynebacterium diphtheriae), Corynebacterium species (corynebacterium sp.), come when Fellow matrix Lucio L of Seattle (Erysipelothrix rhusiopathiae), Clostridium puff ringgereu's (Clostridium perfringers), Clostridium tetani (Clostridium tetani), Enterobacter difficulties I Ness (Enterobacter aerogenes ), Klebsiella pneumoniae , Pasturella multocida , Bacteroides spp. Bacteroides sp.), Pew jobak Te Leeum New Clegg Atum (Fusobacterium nucleatum), Streptococcus, Bacillus monil FORT Miss (Streptobacillus monilformis), Tre Four Cinema Farley Stadium (Treponema pallidium), Tre Four Cinema flops tenyu (Treponema pertenue), Leptospira (Leptospira ), Rickettsia and Actinomyces israelli .
[192] Examples of fungi include Cryptococcus neoformans , Histoplasma capsulatum , Coccidioides immitis , Blastomyces dermatitidis , Chlamydia Trachomatis ( Chlamydia trachomatis ), Candida albicans .
[193] Other infectious organisms (ie, protists) include plastic modium eight Shifa Room (Plasmodium falciparum), plasminogen modium malaria (Plasmodium malariae), plasminogen modium (Plasmodium as Place modium Oval (Plasmodium ovale) and plasminogen modium non Box (Plasmodium vivax) ) Species, and Toxoplasma gondii . Blood-derived and / or tissue parasites include Plasmodium species, Babesia microti , Babesia divergens , Leishmania tropica , Leishmania tropica , Laishmania spp. Leishmania braziliensis , Leishmania donovani , Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi ( Trypanosogas cruzi ) (Chagas' disease) and toxoplasma condyi.
[194] Other medically relevant microorganisms are described extensively in the literature (see, eg, C.G.A Thomas, Medical Microbio1ogy, Bailliere Tindal I, Great Britain l983), the entire contents of which are incorporated herein by reference.
[195] Although many of the microbial antigens described above are associated with human diseases, the present invention is also useful for treating other non-human vertebrates. Non-human vertebrates may also have an infection that can be prevented or treated with the immunostimulatory nucleic acids disclosed herein. For example, in addition to the treatment of infectious human diseases, the methods of the present invention are useful for treating infections in animals.
[196] As used herein, the term “treatment”, “treated” or “treating” when used for an infectious disease increases the subject's resistance to infection with the pathogen, that is, the subject is infected with the pathogen. Prophylactic treatment that reduces the likelihood of becoming a person, as well as treating an infected subject (an infected subject) to combat an infection, for example to reduce or eradicate the infection, or to prevent the infection from worsening.
[197] Many vaccines for the treatment of non-human vertebrates are disclosed in Bennett, K. Compendium of Veterinary Products, 3rd ed. North American Compendiums, Inc., 1995. As discussed above, antigens include infectious microorganisms such as viruses, parasites, bacteria and fungi, and fragments thereof derived or synthesized from natural sources. Infectious viruses of both human and non-human vertebrates include retroviruses, RNA viruses and DNA viruses. This group of retroviruses includes both simple retroviruses and complex retroviruses. Simple retroviruses include subgroups of B-type retroviruses, C-type retroviruses, and D-type retroviruses. An example of a B-type retrovirus is mouse breast tumor virus (MMTV). C-type retroviruses include subgroup C-type group A (including Laus' sarcoma virus (RSV), avian leukemia virus (ALV) and avian myeloblastosis virus (AMV)) and C-type group B (cat leukemia virus) (FeLV), Gibbon Apes Leukemia Virus (GALV), Spleen Necrosis Virus (SNV), Reticuloendotheliosis Virus (RV) and Monkey Sarcoma Virus (SSV). D-type retroviruses include Masson-Pfizer monkey virus (MPMV) and monkey retrovirus type 1 (SRV-1). Complex retroviruses include subgroups of lentiviral, T-cell leukemia virus, and foamy virus. Lentiviruses include HIV-1, but include HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and equine infectious anemia virus (EIAV). T-cell leukemia viruses include HTLV-1, HTLV-II, monkey T-cell leukemia virus (STLV) and bovine leukemia virus (BLV). Effervescent viruses include human effervescent virus (HFV), monkey effervescent virus (SFV) and bovine effervescent virus (BFV).
[198] Examples of other RNA viruses that are antigens in vertebrates include the Orthoreovirus genus (many serotypes of both mammalian avian retroviruses) and the Orbivirus genus [Bluetongk virus, Eugennangee virus]. , Kemerovo virus, African horse sickness virus and Colorado tick fever virus], and Rotavirus genus (human Rotavirus, Nebraska bovine diarrhea virus, monkey Rotavirus, cattle and sheep) Reoviridae virus, including rotavirus, avian rotavirus); Enterovirus genus [Poliovirus, coxsackie virus A and B, small intestine cytopathic human orphan (ECHO) virus, hepatitis A virus, monkey enterovirus, murine encephalomyelitis (ME) virus, poliovirus muris, bovine enterovirus], swine Enterovirus, Cardiovirus genus [Cenomyelitis virus (EMC), Mengovirus], Genus rhinovirus (human rhinovirus containing more than 113 subtypes; other rhinoviruses), and aptoviruses Picornaviridae virus, including the genus Apthovirus [FMDV]; Calciviridae virus, including vesicular rash porcine virus, San Miguel sea lion virus, feline picornavirus and Norwalk virus; Alphavirus genus [East encephalitis virus, Semliki forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus , Ross river virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus], Flavirius genus [yellow fever virus derived from mosquitoes, Dengue virus, Japanese encephalitis virus, St. Louis encephalitis virus , Head Valley encephalitis virus, West Nile virus, Kunjin virus, Central European mite-derived virus, Far Eastern mite-derived virus, Kyasanur forest virus, Roofing III virus virus, Powassan virus, Omsk hemorrhagic fevervirus], Ruby virus virus) in (Rubella virus) and pestiviruses (Pestivirus) in (mucosal disease virus, hog cholera virus, Border disease virus), Toga corruption follicle (Togaviridae) virus that contains; Bunnyvirus genus [Bunyamwera and related viruses, California Encephalitis group virus), Plelevirus genus [Sandfly fever Sicilian virus, Rift Valley fever virus], age Nairovirus genus [Crimean-Congo hemorrhagic fever virus, Nairobi sheep disease virus], and the Uukuvirus genus [Oukuniemi and related) Bunyaviridae virus, including viruses; Influenza virus genus [(influenza virus type A, many human subtypes), swine influenza virus, avian and equine influenza viruses, influenza type B (many human subtypes), influenza type C (possibly distinct genus)] Orthomyxoviridae virus; Paramyxovirus genus (Paralinefluenza virus type 1, Sendai virus, hemocytosis virus, parainfluenza virus types 2 to 5, Newcastle disease virus, mumps virus), Morbillivirus genus (measles virus, subacute sclerosis) pan-encephalitis virus, distemper virus, rinderpest virus), pneumophila virus (Pneumovirus) in (respiratory sum FOCE virus (RSV), bovine respiratory sum FOCE viruses and pneumoniae virus), para Mick spent re follicle (paramyxoviridae) containing the virus; Vesiculovirus (VSV) genus [Candipura virus, Flanders-Hart Park virus], Lyssavirus (rabies virus), Fish Lavdovirus ( fish Rhabdovirus), and two possible Rab FIG virus [Mar bug virus (Marburg virus), and Ebola virus; Rab FIG irregularities follicle (Rhabdoviridae) virus containing; Lymphocytes context meningitis virus (LCM), the other Caribbean virus complex (Tacaribe virus complex) and Rasa viruses (Lassa virus) Arena irregularities follicle (Arenaviridae) virus containing; Coronoaviridae viruses, including, but not limited to, infectious bronchitis virus (IBV), infectious virus, human small intestine coronavirus, and feline infectious peritonitis virus (cat coronavirus).
[199] Exemplary DNA viruses that are antigens in vertebrates include Poxviridae and (Orthopoxvirus) (Variola major, Variola minor, Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia); Leporipoxvirus genus (Myxoma, Fibroma); Avipoxvirus genus (Fowlpox, other avian poxvirus); Capripoxvirus genus (sheeppox, goatpox); Swinepox genus; Genus Parapoxvirus (including infectious postular dermatitis virus, pseudocowpox, bovine papular stomatitis virus); Iridoviridae and [African swine fever virus, Frog viruses 2 and 3, Lymphocystis virus of fish]; Herpesviridae and Herpesviridae [Herpes Simplex Types 1 and 2, Varicella-Zoster, Equine Abortion Virus, Equine Herpes Virus 2 and 3, pseudorabies virus, Infectious Bovine Keratoconjunctivitis Virus, Infectious Bovine Rhinitis Virus, Feline rhinitis virus, infectious laryngitis virus), beta-herpesvirus (human cytomegalovirus and cytomegaloviruses in pigs and monkeys), gamma-herrvirus (EBV), Marek's disease virus, Herpes saimiri, Herpesvirus ateles, Herpes virus sylvilagus, guinea pig herpes virus, Lucke tumor virus); Adenoviridae and [Mastadenovirus genus (human subgroups A, B, C, D, E and those not in the group; monkey adenovirus (more than 23 serotypes), infectious canine hepatitis) And adenoviruses of cattle, pigs, sheep, frogs and many other species); Aviadenovirus genus; And non-cultured adenoviruses; Papoviridae (Human papilloma viruses, bovine papilloma viruses, Shope rabbit papilloma virus, and various other pathogenic papilloma viruses, Polyomavirus, Simian vacuolating agent (SV-40) ), Including rabbit vacuolating agent (RKV), K virus., BK virus, JC virus, and other primate polyoma viruses such as lymphocyte-affinity papilloma virus); Including Parvooviridae and [Adeno-associated virus, Parvovirus genus (cat pancreatic virus, bovine parvovirus, canine parvovirus, Aleutian mink disease virus, etc.) ], But is not limited to such. Finally, DNA viruses can include those not belonging to the family, such as Kuru and Creutzfeldt-Jacob disease viruses and chronic infectious neuropathy (CHINA virus).
[200] Each of the above is merely an example and is not intended to be limiting.
[201] In addition to the use of immunostimulatory nucleic acids to induce antigen specific immune responses in humans, the methods of the preferred embodiments are particularly suitable for the treatment of birds, such as birds such as chickens, chicks, turkeys, ducks, geese, quails and pheasants. . Algae is a major target for many types of infections.
[202] Hatching birds are exposed to pathogenic microorganisms immediately after birth. Against pathogens These birds are initially protected by antibodies derived from the mother, but this protection is only temporary and the bird's own immature immune system must begin protecting the birds against the pathogen. Often, it is desirable to prevent infection of young birds most susceptible to disease. In addition, it is desirable to prevent infectious diseases when mature birds, especially those birds, are bred in enclosed spaces and the disease spreads rapidly. Thus, when antigen is present, it is desirable to administer the immunostimulatory nucleic acid and non-nucleic acid adjuvant of the invention to algae to augment the antigen-specific immune response.
[203] An example of a common infectious disease in chickens is chicken infectious anemia virus (CIAV). CIAV was first isolated in 1979 during the investigation of the Marek's disease vaccination resting period in Japan (Yuasa et al., 1979, Avian Dis. 23: 366-385). Since then, it has been detected in poultry sold in all major poultry producing countries (van Bulow et al., 1991, pp. 690-699 in Diseases of Poultry, 9th edition, Iowa State University Press).
[204] CIAV infection represents a clinical disease characterized by anemia, bleeding and immunosuppression in susceptible young chicks. Atrophy and consistent lesions in the thymus and bone marrow of CIAV-infected chicks are also a hallmark of CIAV infection. Lymphocyte depletion in the thymus, sometimes in the bursa of Fabricius, indicates immunosuppression and increased susceptibility to secondary viral, bacterial or fungal infections, which complicates disease progression. Immunosuppression can cause disease exacerbation after infection with one or more of Marek's disease virus (MDV), infectious cystic disease virus, reticuloendothelial virus, adenovirus or leovirus. The pathogenesis of MDV has been reported to be increased by CIAV (DeBoer et al., 1989, p. 28 In Proceedings of the 38th Western Poultry Diseases Conference, Tempe, Ariz.). CIAV has also been reported to exacerbate signs of infectious cystic disease (Rosenberger et al., 1989, Avian Dis. 33 :: 707-713). Chickens show age-dependent resistance to experimentally induced diseases caused by CAA. Resistance is essentially complete at two weeks of age, but older birds are also susceptible to infection (Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 24, 202-209, 1980). However, when chicks are double infected with CAA and immunosuppressive agents (IBDV, MDV, etc.), age-dependent resistance to disease is delayed (Yuasa, N. et al., 1979 and 1980 supra; Bulow von V. et. al., J. Veterinary Medicine 33, 93-116, 1986). Features of CIAV that can enhance disease inheritance include high resistance to environmental inactivation and certain conventional sterilizing agents. The economic impact of CIAV infection in the poultry industry is evident from the fact that 10% to 30% of infected birds die during disease outbreaks.
[205] Like other vertebrates, vaccination of birds can be performed at any age. Typically, vaccination is performed within 12 weeks of life for live microorganisms and between 14 and 18 weeks for inactivated microorganisms or other types of vaccines. In case of vaccination inside eggs, vaccination can be carried out at the end of embryonic development. The vaccine may be administered subcutaneously, orally, intraocularly, intranasally, or by other mucus delivery methods described herein. That is, the immunostimulatory nucleic acids of the present invention may be administered to birds and other non-human vertebrates in accordance with conventional vaccination schemes, and the antigen may be administered after a suitable time as described herein.
[206] Cows and livestock are also susceptible to infection. Diseases affecting these animals can cause serious economic losses, especially for cattle. The methods of the present invention can be used to protect livestock such as cattle, horses, pigs, sheep and goats against infection.
[207] Cows can be infected by bovine viruses. Bovine viral diarrhea virus (BVDV) is a small encapsulated positive-strand RNA virus and is classified in the pest virus into swine cholera virus (HOCV) and sheep soft disease virus (BDV). Although plagueviruses have already been classified into the Togaviridae family , several studies have suggested that they reclassify into Flavivirus and hepatitis C virus (HCV) families in the Flaviviridae family (Francki, et al., 1991).
[208] BVDV, an important pathogen of cattle, can be divided into cytopathogenic (CP) and non-cytopathogenic (NCP) biotypes based on cell culture assays. Both of these biotypes can be found in cattle, but the NCP biotypes are more extensive. If the conceived cow is infected with the NCP strain, it will give rise to a long incubated, particularly immunotolerant calf, which will spread the virus throughout its life. Such long incubated infected cattle can die due to mucosal disease, after which the two biotypes can be isolated from dead animals. Clinical signs can include miscarriage, teratogenicity and respiratory disease, mucus disease and mild diarrhea. In addition, severe thrombocytopenia associated with bovine infectious diseases can result in death of these animals, and strains associated with these diseases appear to be more lethal than typical BVDV.
[209] Equine herpes virus (EHV) consists of a group of antigenically distinct biological substances that cause various infectious diseases from pre-clinical to prenatal disease in horses. Such viruses include Equine Herpes Virus-1 (EHV-1), a pathogen ubiquitous in equine. EHV-1 is associated with infectious diseases, respiratory diseases and central nervous system diseases that cause miscarriage. Primary infection of the upper respiratory tract of young horses causes a fever disease that lasts for 8 to 10 days. Mares with an immune experience can be reinfected with the respiratory tract, and the disease can usually be aborted without notice because the disease is not evident. Neurological syndromes are associated with respiratory disease or miscarriage and can affect animals of any age of each gender, resulting in loss of synergy, weakness and posterior paralysis (Telford, EAR et al., Virology 189, 304-3 16, 1992). Other EHVs include EHV-2, or Equine Cytomegalovirus, EHV-3, Equine Hip Oscillation Virus, and EHV-4, previously classified as EHV-1 Subtype 2.
[210] Sheep and goats can be infected by a variety of dangerous microorganisms, including visna-maedi.
[211] Primates such as monkeys, apes and macaques can be infected by monkey immunodeficiency virus. Inactivated cell-virus and cell-free whole monkey immunodeficiency vaccines have been reported to perform protection in macaques (Stott et al. (1990) Lancet 36: 1538-1541; Desrosiers et al. PNAS USA (1989) 86: 6353-6357; Murphey-Corb et al. (1989) Science 246: 1293-1297; and Carlson et al. (1990) MDS Res. Human Retroviruses 6: 1239-1246). Recombinant HIV gp120 vaccines have been reported to perform protection in chimpanzees (Berman et al. (1990) Nature 345: 622-625).
[212] Both domesticated cats and wild cats are susceptible to infection by various microorganisms. For example, feline infectious peritonitis is a disease that occurs in both reared cats and wild cats, such as lions, leopards, cheetahs and jaguars. If it is necessary to prevent infections of these and other types of pathogenic organisms in cats, the methods of the invention can be used to vaccinate cats to protect them from infection.
[213] Breeding cats can be infected with several retroviruses, including but not limited to feline leukemia virus (FeLV), feline sarcoma virus (FeSV), and feline syncytia-forming virus (FeSFV). Among these, FeLV is the most important pathogen and causes various symptoms including lymphatic reticulum and bone marrow tumors, anemia, immune mediated diseases, and immunodeficiency syndrome (MDS) similar to human acquired immunodeficiency syndrome. Recently, it has been found that replication-defective FeLV mutations named FeLV-AIDS have a more specific correlation with immunosuppressive properties.
[214] The discovery of feline T-lymphophilic lentivirus (also known as feline immunodeficiency) was first reported in Pedersen et al. (1987) Science 235: 790-793. Characteristics of FIV are described in Yamamoto et al. (1988) Leukemia, December Supplement 2: 204S-2158; Yamamoto et al. (1988) Am. J. Vet. Res. 49: 1246-1258; and Ackley et al. 1990) J. Virol. 64: 5652-5655. Cloning and sequencing of FIVs was reported in Olmsted et al. (1989) Proc. Natl. Acad. Sci. USA 86: 2448-2452 and 86: 4355-4360.
[215] Feline infectious peritonitis (FIP) is a rare disease that occurs unexpectedly in reared cats and wild cats. Although FIP is a predominant disease in cats bred, it has also been diagnosed in lions, mountain lions, leopards, cheetahs and jaguars. Smaller wild cats suffering from FIP include lynx and caracal, sand cat and pallas cat. In breeding cats, the disease occurs mainly in young animals, but cats of all ages are susceptible to the disease. The disease occurs maximally in cats between 6 and 12 months of age. The decrease in incidence was evident in cats 5 to 13 years of age, and then increased in 14 to 15 years of age.
[216] Viral, bacterial and parasitic diseases in pin-fish, shell-fish or other aquatic organisms pose serious problems for the aquaculture industry. Due to the high density of animals in the hatching tanks or enclosed marine aquaculture areas, infectious diseases can wipe out most of the animal population, such as pin-fish, shell-fish or other aquatic organisms. Preventing disease from these threats to fish is a better therapy than treating when the disease occurs. Vaccination of fish is the only preventive method that can provide long-term protection through immunization. Nucleic acid vaccinations are described in US Pat. No. 5,780,448 to Davis.
[217] The fish immune system has many features similar to the mammalian immune system, such as for example the presence of B cells, T cells, lymphokines, complement and immunoglobulins. Fish have a lymphocyte subclass that serves to appear to be similar in many respects to that of mammalian B and T cells. The vaccine can be administered by immersion or orally.
[218] Aquatic species include but are not limited to pin-fish, shell-fish and other aquatic animals. Fin-fish includes all vertebrate fish, which may be, for example, tibia or cartilaginous fish such as salmonid, carp, catfish, yellowtail, seabream and seabass. . Salmon is a family of pin-fish that includes trout (including rainbow trout), salmon and arctic whisks. Examples of shell-fish include but are not limited to shellfish, prawns, barley shrimp, crabs and oysters. Other farmed aquatic animals include, but are not limited to, eel, squid and octopus.
[219] Polypeptides of viral pathogens of aquaculture organisms include glycoproteins (G) or nucleoproteins (N) of viral hemorrhagic sepsis virus (VHSV); G or N protein of infectious hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural proteins of infectious pancreatic necrosis virus (IPNV); Carp spring virus (SVC); And membrane binding proteins, tegumin or capsid proteins or glycoproteins (CCV) of channel catfish virus (CCV).
[220] Typical parasites that infect horses include Gasterophilus spp . ; Eimeria leuckarti , Giardia spp . ; Tritrichomonas equ i; Babesia spp. (RBC's), Theileria equi ; Trypanosoma spp . ; Klossiella equi ; Sarcocystis spp .
[221] Typical parasites that infect pigs include Eimeria bebliecki , Eimeria scabra , Isospora suis , Giardia spp . ; Balantidiuln coli , Entamoeba histolytica ; Toxoplasma gondii and Sarcocystis spp. , And Trichinella spiralis.
[222] Major parasites in cows and beef cattle include Eimeria spp. , Cryptosporidium sp. , Giardia spp . ; Toxoplasma gondii ; Babesia bovis (RBC), Babesia bigemina (RBC), Trypanosoma spp. (Plasma), Theileria spp. (RBC); Theileria parva (lymphocytes); Tritrichomonas foetus ; And Sarcocystis spp .
[223] Major parasites of raptors include Trichomonas gallinae ; Coccidia ( Emeria spp.); Plasmodium relictum , Leucocytozoon danilewskyi (owl), Haemoproteus spp ., Trypanosoma spp . ; Histomonas ; Cryptosporidium meleagridis , Cryptosporidium baileyi , Giardia , Eimeria ; Toxoplasma is plasma containing the (Toxoplasma).
[224] Typical parasites that infect sheep and goats include Eimeria spp. , Cryptosporidium sp. , Giardia sp . ; Toxoplasma gondii ; Babesia spp. (RBC), Trypanosoma spp. (Plasma), Theileria spp. (RBC); And Sarcocystis spp .
[225] Typical parasitic infections in poultry include Eimeria acervulina , E. coli . Necattrix , Lee. Coccidiosis caused by E. tenella , Isospora spp. And Eimeria truncata ; Histomonosis caused by Histomonas meleagridis and Histomonas gallinarum ; Trichomoniasis caused by Trichomonas gallinae; And hexamitiasis caused by Hexamita meleagidis . Poultry is also AIME Ria film Shima (Emeria maxima), Aime Ria Mel Leah, so display (Emeria meleagridis), this Almeria adeno this Rhodes (Eimeria adenoeides), this Almeria Mel Leah Grimmy teeth (Eimeria meleagrimitis), Cryptosporidium (Cryptosporidium), this Eimeria brunetti , Emeria adenoeides , Leucocytozoon spp. , Plasmodium spp. , Hemoproteus meleagidis , Toxoplasma gon It can also be infected by Toxoplasma gondii and Sarcocystis .
[226] The methods of the invention may also be applied to treat and / or prevent parasitic infections in dogs, cats, birds, fish and ferrets. Typical parasites of algae include Trichomonas gallinae ; Eimeria spp. , Isospora spp. , Giardia ; Cryptosporidium (Cryptosporidium); Sarcocystis spp. , Toxoplasma gondii , Haemoproteus / Parahaemoproteus , Plasmodium spp. , Leucocytozoon / Lacicocytozoon ( Akiba ), Atoxoplasma , Trypanosoma spp. Common parasites that infect dogs include Trichinella spiralis ; Isopora spp. , Sarcocystis spp. , Cryptosporidium spp. , Hammondia spp. , Giardia duodenalis (canis) ; Balantidium coli , Entamoeba histolytica ; Hepatozoon canis ; Toxoplasma gondii , Trypanosoma cruzi ; Babesia canis ; Leishmania amastigotes ; Neospora caninum is included.
[227] Common parasites that infect cat species include Isospora spp. , Toxoplasma gondii , Sarcocystis spp. , Hammondia hammondi , and Vesnoy . Tia species ( Besnoitia spp. ), Giardia spp . ; Entamoeba histolytica ; Hepatozoon canis , Cytauxzoon sp. , Cytauxzoon sp. , Cytauxzoon sp. (Red cells, RE cells).
[228] Typical parasites that infect fish include Hexamita spp. , Eimeria spp . ; Cryptococcus via species (Cryptobia spp.), Nose town species (Nosema spp.), Slow-speed Soma species (Myxosoma spp.), Kilo donelra species (Chilodonella spp.), Tricot Dina species (Trichodina spp.), Fleece Sat Fora species ( Plistophora spp. ), Myxosoma Henneguya ; Costia spp. , Ichthyophithirius spp. , And Oodinium spp .
[229] Typical parasites of wild mammals include Giardia spp. (Carnivores, herbivores), Isospora spp. (Carnivores), Eimeria spp. (Carnivores, Herbivores); Teileria spp. (Herbivore), Babesia spp. (Predator, herbivore), Trypanosoma spp. (Predator, herbivore); Schistosoma spp. (Herbivore); Fasciola hepatica (herbivore), Fascioloides magna (herbivore), Fasciola gigantica (herbivore), Trichinella spiralis ( Trichinella spiralis ) (Carnivores, herbivores).
[230] Parasitic infections in zoos can also cause serious problems. Bobby vs. (bovidae) and [Blessing Book (blesbok), ruminant animals such as antelope (antelope), southeast Asian buffalo (banteng), South African eland (eland), Indian big bison (gaur), Ah-free Shanshan nutrition (impala ), South African klipspringer, South African kudu, gazelle] include Eimeria spp . Typical parasites of pinnipedae and (sea leopards, sea lions) include Eimeria phocae. Typical parasites of camelidae and camels ( Illamas ) include Eimeria spp. Typical parasites of giraffidae and (giraffe) include Eimeria spp . Eleanor is a typical plate of parasites tidae (elephantidae) and (African and Asian Elephant) is Pacifico include the kind of climb (Fasciolaspp.). Typical parasites of lower primates (chimpanzees, orangutans, apes, baboons, macaques, monkeys) include Giardia sp . ; Balantidium coli , Entamoeba histolytica , Sarcocystis spp. , Toxoplasma gondii ; Plasmodim spp. (RBC), Babesia spp. (RBC), Trypanosoma spp. (Plasma), Leishmania spp. (Macrophage) do.
[231] Polypeptides of bacterial pathogens include iron-regulated outer membrane protein (IROMP), outer membrane protein (OMP), and the A-protein, bacterial kidney of Aeromonis salmonicida, which causes furuncu1osis. P57 protein of Renibacterium salmoninarum , a major surface binding antigen (msa), surface expressed cytotoxin (mpr), surface expressed hemolysin (ish), and Yersi causing disease (BKD) Flagella protein of Yersiniosis; Structural proteins of extracellular protein (ECP), iron-regulated outer membrane protein (IROMP), and Pasteurellosis; Vibrosis anguillarum and v. OMP and flagella proteins of V. ordalii ; Edwardsiellosis ictaluri and E. coli . Flagella protein, OMP protein, aroA, and purA from E. tarda; And surface antigens of Ichthyophthirius ; And structural and regulatory proteins of Cytophaga columnari ; And Rickettsia 's structural and regulatory proteins.
[232] Polypeptides of parasitic pathogens include, but are not limited to, surface antigens of Ichthyophthirius .
[233] Allergen refers to a substance (antigen) capable of inducing an allergic or asthmatic reaction in a subject susceptible to infection. There are many types of allergens and may include pollen, insect poisons, animal dandruff powder, fungal spores and drugs (eg penicillin). Examples of natural animal and plant allergens include, but are not limited to, proteins specific to the following genus: Canine (Canis familiaris); Dermatophagoides (eg, Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia); Lolium (eg Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alteraria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (eg, Plantago lanceolata); Parietaria (eg, Parietaria officinalis or Parietaria judaica); Blatella (eg Blattella germanica); Apis (eg Apis multiflorum); Cupressus (eg, Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniferus (eg, Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperusashei); Thuya (eg, Thuya orientalis); Chamaecyparis (eg, Chamaecyparis obtusa); Periplaneta (eg, Periplaneta americana); Agropyron (eg, Agropyron repens); Secale (eg Secale cereale); Triticum (eg, Triticum aestivum); Dactylis (eg, Dacfylis glomerata); Festuca (eg Festuca elatior); Poa (eg Poa pratensis or Poa compressa); Avena (eg, Avena sativa); Holcus (eg Holcus lanatus); Anthoxanthum (eg, Anthoxanthum odoratum); Arenarrum (for example Arrhenatherum elatius); Agrostis (eg, Agrostis alba); Phleum (eg, Phleum pratense); Phalaris (eg Phalaris arundinacea); Paspalum (eg Paspalum notatum); Sorghum (eg, Sorghum halepensis); And Bromus (eg Bromus inermis).
[234] The antigen may be an antigen encoded by a nucleic acid vector or the antigen may not be coated in the nucleic acid vector. In the former case, the nucleic acid vector is administered to a subject and the antigen is expressed in vivo. In the latter case, the antigen can be administered directly to the subject. As used herein, an antigen that is not encoded in a nucleic acid vector means any kind of antigen that is not a nucleic acid. For example, in some aspects of the invention, the antigen that is not encoded in a nucleic acid vector is a polypeptide. Some modifications in the major amino acid sequence of a polypeptide antigen may also form polypeptides having substantially equivalent antigenic activity as compared to the corresponding unmodified polypeptide. Such modifications may be artificial or naturally occurring by site-directed mutagenesis. All polypeptides produced by such modifications are included herein as long as antigenicity is present. The polypeptide can be, for example, a viral polypeptide.
[235] As used herein, the term substantially purified means a polypeptide that is substantially free of other proteins, lipids, carbohydrates, or other substances that are naturally bound. Those skilled in the art can purify viral or bacterial polypeptides using standard techniques for protein purification. Substantially pure polypeptide will often form a single major band on a non-reducing gel. For partially glycosylated polypeptides or polypeptides having several initiation codons, there may be several bands on the non-reducing polyacrylamide gel, but they will form a distinct pattern for this polypeptide. The purity of the viral or bacterial polypeptide can also be determined by amino-terminal amino acid sequencing. Other types of antigens that are not encoded by nucleic acid vectors, such as polysaccharides, small molecules, mimetics, and the like, are described above and are included in the present invention.
[236] The invention also utilizes polynucleotides encoding antigenic polypeptides. It is contemplated that such antigens may be delivered to a subject as nucleic acid molecules encoding antigens so that they are expressed in vivo. Such antigens delivered to a subject in a nucleic acid vector are called antigens encoded by the nucleic acid vector. The nucleic acid encoding the antigen is operably linked to gene expression sequences that direct expression of the antigenic nucleic acid in eukaryotic cells. A gene expression sequence is any regulatory nucleotide sequence that facilitates efficient transcription and translation of an operably linked antigenic nucleic acid, eg, a promoter sequence or promoter-enhancer combination. The gene expression sequence can be for example a mammalian or viral promoter, for example a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, promoters of the following genes: hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate kinase, b-actin promoter and other constitutive promoters. Examples of viral promoters that act constitutively in eukaryotic cells include cytomegalovirus (CMV), monkey virus (eg SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), loose sarcoma virus, Long terminal repeats (LTR) of cytomegalovirus, Mo1oney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those skilled in the art. Promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of inducers. For example, metallothionein promoters are induced in the presence of certain metal ions to promote transcription and translation. Other inducible promoters are known to those skilled in the art.
[237] In general, gene expression sequences include 5'-transcription and 5'-nontranscription sequences, such as TATA boxes, capping sequences, CAAT sequences, etc., which are involved in initiation of transcription and translation, respectively, as needed. In particular, such 5'-nontranscriptional sequences will comprise a promoter region comprising a promoter sequence for transcriptional regulation of operably linked antigenic nucleic acid. Optionally, the gene expression sequence includes an enhancer sequence or an upstream activator sequence, if necessary.
[238] Antigen nucleic acids are operably linked to gene expression sequences. As used herein, antigenic nucleic acid sequences and gene expression sequences operate when they are operably linked in such a way that they perform expression, or transcription and / or translation, of the antigen coding sequence under the influence or control of the gene expression sequence. Say it is possible. When the induction of the promoter in the 5 'gene expression sequence transcribs the antigen sequence, and the linking properties between the two DNA sequences do not (1) induce frame-shift mutations, or (2) promoter regions that direct transcription of the antigen sequence. The two DNA sequences are said to be operably linked if they do not interfere with (3) or the ability of the corresponding RNA transcript to be translated into protein. That is, the gene expression sequence is operably linked to the antigenic nucleic acid sequence when the gene expression sequence is capable of transcription of the antigenic nucleic acid sequence so that the resulting transcript is translated into the protein or polypeptide of interest.
[239] Antigen nucleic acids of the invention can be delivered to the immune system alone or in combination with a vector. In the broadest sense, a vector is any carrier capable of facilitating delivery of antigenic nucleic acid to immune system cells such that the antigen can be expressed and presented at the surface of the immune cell. Vectors generally carry nucleic acids into immune cells and reduce degradation relative to the extent of degradation that occurs in the absence of the vector. Vectors optionally include the gene expression sequences described above to increase expression of antigenic nucleic acid in immune cells. In general, vectors useful in the present invention include, but are not limited to, plasmids, phagemids, viruses, and other carriers derived from viral or bacterial sources engineered by insertion or incorporation of antigenic nucleic acid sequences. Viral vectors are the preferred vector types, including, for example, Molonei rat leukemia virus, Harvey rat sarcoma virus, rat breast tumor virus, and Loose sarcoma virus; Adenovirus, adenovirus; SV40-type virus; Polyoma virus; Epstein-Barr virus; Papilloma virus; Herpes virus; Vaccinia virus; Polio virus; And nucleic acid sequences derived from RNA viruses, such as retroviruses. Other vectors are readily available to those skilled in the art without enumeration.
[240] Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with genes of interest. Non-cytopathic viruses include retroviruses whose life cycles include reverse transcription of genomic viral RNA into DNA followed by integration of the provirus into host cell DNA. Retroviruses were licensed in human gene therapy experiments. Retroviruses that are replication-defective (ie, can direct the synthesis of the protein of interest, but cannot produce infectious particles) are most useful. Genetically modified such retroviral expression vectors are generally useful for high-efficiency transduction of genes in vivo. Standard protocols for the production of replication-defective retroviruses (incorporation of external genetic material into plasmids, transfecting package cell lines with plasmids, producing recombinant retroviruses by package cell lines, tissue culture medium Harvesting viral particles from, and infecting target cells with viral particles, see Kriegler, M., Gene Transfer and Expression, A Laboratory Manual WH Freeman CO, New York (1990) and Murry, EJ Methods in Molecular Biology, vo1. 7, Humana Press, Inc., Cliffton, New Jersey (1991).
[241] In some cases, preferred viruses are adeno-based viruses, double-stranded DNA viruses. Adenoviruses are replication-defective and can be engineered to infect a wide variety of cell types and species. In addition, thermal stability and lipid solvent stability; High transduction frequency in cells of various lineages, including hematopoietic cells; And due to the lack of inhibition of over-infection there are advantages such as to enable a variety of transduction. As recently reported, adenoviruses can be integrated in a site-specific manner into the DNA of human cells, thereby minimizing the likelihood of insertion mutagenesis and changes in inserted gene expression. In addition, wild-type adeno-based virus infections were performed during 100 or more passages in the absence of selection conditions in tissue culture, suggesting that adeno-based virus genome integration is a relatively stable response. Adenoviruses may also act in an extrachromosomal manner.
[242] Other vectors include plasmid vectors. Plasmid vectors are widely described in the technical literature of the art and are well known to those skilled in the art (see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Habor Laboratory Press, 1989). ]. In recent years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because they cannot be replicated in the host genome and integrated into the genome. However, such plasmids with promoters suitable for host cells can express peptides from genes operably encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC / CMV, SV40, and pBlueScript. Other plasmids are well known to those skilled in the art. In addition, restriction enzymes and ligation reactions can be used to routinely design plasmids to remove and add specific DNA fragments.
[243] Recently, it has been found that vectors can be used to deliver genes carrying a plasmid to the immune system. Salmonella can be transfected with modified forms of bacteria such as plasmids to be used as delivery vehicles. The bacterial delivery vehicle may be administered to the host subject by oral or other method of administration. Bacteria deliver plasmids to immune cells, such as B cells, dendritic cells through the intestinal barrier. This method was used to establish a high level of immune protection. Such methods of delivery are useful in aspects of the present invention that utilize systemic delivery of antigens, immunostimulatory nucleic acids, and / or other therapeutic agents.
[244] Thus, immunostimulatory nucleic acids are useful as vaccine adjuvants. It is already known that CpG oligonucleotides are good vaccine adjuvants. However, it has also been demonstrated that CpG ODN, an excellent vaccine adjuvant in rats, is not a preferred adjuvant in non-rodent animals. In vivo screening of several nucleic acids was performed for this purpose to identify the optimal immunostimulatory nucleic acids used as vaccine adjuvant in humans and other non-rodent animals. Several in vitro assays assessed the expected in vivo adjuvant activity in mice. During this course of study, in vitro tests were identified that anticipated efficacy in vivo. Somewhat surprisingly, it has been found that B cell and NK cell activation correlate particularly well with the ability of immunostimulatory nucleic acids to enhance an immune response in vivo against antigens.
[245] Good estimates of B cell activation for the adjuvant activity of the vaccine in vivo were most likely related to the central role of B cells in the establishment of specific immune responses. Polyclonal proliferation of B cells (induced by immunostimulatory nucleic acids) increases the likelihood of matching antigen specific B cells / T helper cells. In addition, increased expression of the costimulatory molecule CD86 on polyclonal expanded B cells activates antigen specific T helper cells. B cells also increase their CD40 expression in response to immunostimulatory nucleic acids which enhance the ability of activated T helper cells to stimulate CD40L expression. Increased ICAM-1 synthesis on B cells promotes cell-to-cell contact. Thus, the activation state of polyclonal B cells plays an important role during the initiation of specific antibody responses.
[246] However, the contribution of NK cell activity to the establishment of specific antigens was surprising. NK cells are part of the innate immune system and are themselves involved in the first line in defense against pathogens. The pattern of cytokines produced by NK cells upon activation is closely related to the onset of specific immune responses. Thus, in one aspect, the invention relates to a method for identifying an adjuvant by detecting the activity of NK cells. Assays of NK cell activity can be performed as described in the Examples below or using other known NK cell activity assays. However, it is preferable to use a mixed cell population such as PBMC due to the possibility that NK cell activation is an indirect effect. The assay is preferably useful for identifying immunostimulatory nucleic acids useful as adjuvants in humans and other non-rodent animals.
[247] Cytokine induction has also been found to be an important example of adjuvant activity in vivo. However, since humans have a higher endotoxin sensitivity of log 2 than mouse primary monocytes, care must be taken to prevent endotoxin contamination of immunostimulatory nucleic acids used for testing in human systems (Hartmann G., and Krieg AM 1999. Gene Therapy 6: 893). Since TNF-α, IL-6 and IL-12 are produced by human monocytes in response to even small amounts of endotoxins, their values are limited in high throughput in vitro screening assays. Human B cells and NK cells, on the other hand, are much more useful for testing immunostimulatory activity because they show only a slight activation by endotoxin.
[248] Stimulation of cell function (ie lytic activity, proliferation) in NK or B cells requires stronger immunostimulatory nucleic acids than induction of activity markers (CD69, CD86) on their surface. For both cell types, the use of cell surface activation markers showed a higher nonspecific background value contributing to the phosphorothioate backbone compared to the functional assay. Such highly sensitive surface markers require the use of low immunostimulatory nucleic acid concentrations for optimal differentiation between similarly active immunostimulatory nucleic acids. Thus, surface markers can be used to compare immunostimulatory nucleic acids with weak activity, but functional assays are preferred for comparing immunostimulatory nucleic acids with high activity. It is noteworthy that the optimal immunostimulatory nucleic acid concentrations for stimulation of B cells and NK cells differ. While 0.6 μg / ml ODN is the maximum to stimulate B cells, optimal NK cell activation may require 6 μg / ml ODN. B cell activation and NK cell function activity were measured in freshly isolated PBMCs. It is already known that highly purified human primary B cells are activated by CpG DNA. It is not clear whether CpG DNA has a direct effect on NK cells, and a second mechanism mediated by other cell types in PBMCs may contribute to CpG-induced functional activity of NK cells.
[249] Nucleic acids of the invention can be administered to a subject in combination with an anti-microbial agent. As used herein, an anti-microbial agent means a naturally occurring or synthetic compound capable of killing or inhibiting an infectious microorganism. The type of anti-microbial agent useful according to the present invention will depend on the type of microorganism that infects or is at risk of infecting the subject. Anti-microbial agents include, but are not limited to, antibacterial, antiviral, antifungal and antiparasitic agents. The terms "anti-infective agent", "antibacterial agent", "antiviral agent", "antifungal agent", "antiparasitic agent" and "parasitic insecticide" are well defined by those skilled in the art and defined in standard medical books. It is. In sum, antibacterial agents kill or inhibit bacteria and include antibiotics as well as other natural or synthetic compounds with similar functions. Antibiotics are low molecular weight molecules produced by a cell, for example a microorganism, as a second metabolite. In general, antibiotics interfere with the function or structure of one or more bacteria that are specific for the microorganism and are not present in the host cell. Antiviral agents can be isolated or synthesized from natural sources and are useful for killing or inhibiting viruses. Antifungal agents are used to treat temporary primary systemic fungal infections as well as superficial fungal infections. Anti-parasites kill or inhibit parasites.
[250] In addition, examples of anti-parasitic agents, also known as parasitic agents useful for administration to humans, include avendazole, amphotericin B, benzidazole, bithionol, chloroquine HCl, chloroquine phosphate, clindamycin, dehydroemethine, diethyl Carbamagine, diloxanide furoate, eflonitine, furazolidaone, glucocorticoid, halophantrin, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimonyate, melalsoprolol , Metrifonate, metrinidazole, niclosamide, nifurtimox, oxamniquine, paromomycin, pentamidine, isethionate, piperazine, praziquantel, primaquine phosphate, proguanil, pyran Tel pamoate, pyrimethane-sulfonamide, pyrimethane-sulpadoxin, quinacrine HCl, quinine sulfate, quinidine gluconate, spiramycin, stybogluconate sodium (sodium antimony glucone T), suramin, tetracycline, doxycycline, thibenzodazole, tinidazole, trimeroprim-sulfamethoxazole, and triparasamide, some of which are alone or in combination with others Used together.
[251] Parasitic agents used in non-human subjects include piperazine, diethylcarbazine, thibendazole, fenbendazole, albendazole, oxpendazole, oxybendazole, pevantel, levamisol, pyrantel tartrate , Pyrantel pamoate, dichlorbose, ivermectin, doramethin, milbamycin oxime, iprinomectin, moxidecetine, N-butyl chloride, toluene, hygromycin B thiacetarsemide sodium, melashamine, pra Giquantel, epsifrantel, benzimidazoles, for example fenbendazole, albendazole, oxpendazole, chlorsulone, albendazole, ampprolium; Decoquinate, lasaloside, monensin sulfadimethoxine; Sulfamethazine, sulfaquinoxaline, metronidazole.
[252] Useful parasitic agents in horses include mebendazole, oxendazole, pevantel, pylantel, dichlorbos, trichlorphone, ivermectin, piperazine (for S. westeri); Ivermectin, benzimidazoles such as thiabendazole, campbendazole, oxybendazole and fenbendazole. Useful parasitic agents in dogs include milbamycin auxin, ivermectin, pyrantel pamoate, and a combination of ivermectin and pyrantel. Use in the treatment of parasites in pigs can include levamisol, piperazine, pyrantel, thiavendazole, dichlorbose and fenbendazole. In sheep and goats, repellents include levamisol or ivermectin. Kappasolate D. from cats. It has shown some efficacy in the treatment of D. immitis (heartworm).
[253] Antibacterial agents kill or inhibit the growth or function of bacteria. A large group of antibacterial agents are antibiotics. Antibiotics that are effective in killing or inhibiting various bacteria are called broad spectrum antibiotics. Other types of antibiotics are mainly effective against bacteria of the gram positive or gram negative class. This type of antibiotic is called an antibiotic with a narrow spectrum. Other antibiotics that are effective against a single organism or disease but not against other types of bacteria are called antibiotics with a limited spectrum. Antibacterial agents are often classified based on their main mode of action. In general, antibacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors.
[254] Antibacterial agents useful in the present invention include natural penicillin, semi-synthetic penicillin, clavulanic acid, cephalosporin, vacitracin, ampicillin, carbenicillin, oxacillin, azolocillin, mezlocillin, piperacillin, methi Caffeine, Dicloxacillin, Naphcillin, Cephalotin, Sephapirine, Cephalexin, Sephamandol, Sephachlor, Sephazoline, Sepuloxine, Sepoxitine, Cytoxime, Sepulsedine, Sepetameth, Sepiksim, Ceftriaxone, Cefferazone, Ceftazidine, Moxatamtam, Carbapenem, Imiphenem, Monobactem, Yuztreonam, Vancomycin, Polymyxin, Ampofherisin B, Nistatin, Imidazole, Clotrimazole, Myco Nazol, ketoconazole, itraconazole, fluconazole, rifampin, ethambutol, tetracycline, chloramphenicol, macrolide, aminoglycoside, streptomycin, kanamycin, tobramycin, amikacin, gentamicin, tetracycline, minocin Cyclin, doxycycline, chlortetracycline, erythromycin, oxythromycin, clarithromycin, oleandomycin, azithromycin, chloramphenicol, quinolone, co-trimoxazole, norfloxacin, ciprofloxacin, enoxacin, nalidic Acid, temefloxacin, sulfonamide, gantrycin and trimetapririm; Acesadone; Acetosulfone sodium; Alamesin; Alexidine; Amdinocillin; Amdinocillin coating chamber; Amicycline; Amifloxacin; Amifloxacin mesylate; Amikacin; Amikacin sulfate; Aminosalicylic acid; Aminosalicylate sodium; Amoxicillin; Ampomycin; Ampicillin; Ampicillin sodium; Apalcillin sodium; Apramycin; Aspartosine; Astromycin sulfate; Abilamycin; Aboparcin; Azithromycin; Azolocillin; Azolocillin sodium; Bacampicillin hydrochloride; Bacitracin; Bacitracin methylene disalicylate; Bacitracin zinc; Bambermycin; Benzoylpas calcium; Verithromycin; Betamycin sulfate; Viapenem; Biniramycin; Biphenamine hydrochloride; Bispyrithione magsulpex; Butikacin; Butyrosine sulfate; Capreomycin sulfate; Carbadox; Carbenicillin disodium; Carbenicillin indanyl sodium; Carbenicillin phenyl sodium; Carbenicillin potassium; Carumone sodium; Sephachlor; Cepadroxyl; Sephamandol; Sephamandol Napate; Cephamandol sodium; Cefaparol; Sephatrizin; Sephazaflu sodium; Cefazoline; Cefazoline sodium; Cefebuferazone; Ceftineier; Cefepime; Cefepime hydrochloride; Cefetechol; Sepiksim; Ceftenoxime hydrochloride; Cefmetazole; Ceftmethazole sodium; Ceniside monosodium; Ceniside sodium; Cepharazone sodium; Celandide; Cefotaxime sodium; Cetetane; Cetetane disodium; Cell thiam hydrochloride; Sepoxycitin; Sepoxytin sodium; Cefemizol; Cefemizole sodium; Ceftyramide; Ceftyramide sodium; Ceftyromium sulfate; Cytotoxic proxetyl; Ceftrozil; Ceproxadine; Ceftsulodine sodium; Ceftazidime; Ceftutibutene; Ceftizone sodium; Ceftriaxone sodium; Cefuroxime; Spuroxime axetyl; Cefuroxime coated cetyl; Cefuroxime sodium; Cephacetyl sodium; Cephalexin; Cephalexin hydrochloride; Cephaloglycine; Cephaloridine; Cephalotin sodium; Cepapirine sodium; Cepradine; Cetocycline hydrochloride; Cetophenicol; Chloramphenicol; Chloramphenicol palmitate; Chloramphenicol pantothenate complexes; Chloramphenicol sodium succinate; Chlorhexidine phosphanilate; Chloroxylenol; Chlortetracycline bisulfate; Chlortetracycline hydrochloride; Synoxacin; Ciprofloxacin; Ciprofloxacin hydrochloride; Sirolemycin; Clarithromycin; Clinafloxacin hydrochloride; Clindamycin; Clindamycin hydrochloride; Clindamycin palmitate hydrochloride, clindamycin phosphate; Clofazimin; Cloxacillin benzatin; Cloxacillin sodium; Clock sequence; Collistimate sodium; Colistin sulfate; Coumaycin; Comermycin sodium; Cyclacillin; Cycloserine; Dalfopristin; Daphson; Daphtomycin; Demeclocycline; Demeclocycline hydrochloride; Demesinline; Denofenzin; Diaberridine; Dicloxacillin; Dicloxacillin sodium; Dihydrostreptomycin sulfate; Dipyrithione; Dirithromycin; Doxycycline; Doxycycline calcium; Doxycycline phosphattex; Doxycycline cyclate; Droxacin sodium; Enoxacin; Epicillin; Epitetracycline hydrochloride; Erythromycin; Erythromycin acylate; Erythromycin estholate; Erythromycin ethyl succinate; Erythromycin glucetate; Erythromycin lactobionate; Erythromycin propionate; Erythromycin stearate; Ethambutol hydrochloride; Ethionamide; Fleoxacin; Floxacillin; Fludalanine; Flumequin; Fosfomycin; Fosfomycin tromethamide; Fumoxicillin; Furazolium chloride; Furazolium tartrate; Pushdate sodium; Fusidic acid; Gentamicin sulfate; Glomomoam; Gramicidine; Haloprogin; Hetacillin; Hetacillin potassium; Hexadine; Ibafloxacin; Imipenem; Isoconazole; Isepamycin; Isoniazid; Probemycin; Kanamycin sulfate; Chitasamycin; Lebofuraltadon; Levopropylsilin potassium; Rextromycin; Lincomycin; Lincomycin hydrochloride; Romefloxacin; Romefloxacin hydrochloride; Romefloxacin mesylate; Loracarbef; Mafenide; Meclocycline; Meclocycline sulfosalicylate; Megalomycin potassium phosphate; Mequidox; Meropenem; Metacycline; Metacycline hydrochloride; Methenamin; Methenamin hypofurate; Methenamin mandelate; Methicillin sodium; Metioprim; Metronidazole hydrochloride; Metronidazole phosphate; Mezlocillin; Mezlocillin sodium; Minocycline; Minocycline hydrochloride; Mircamycin hydrochloride; Monensin; Monensin sodium; Naphcillin sodium; Nalidixate sodium; Nalidic acid; Natamycin; Nebramycin; Neomycin palmitate; Neomycin sulfate; Neomycin undecylenate; Netylmycin sulfate; Neutramycin; Nifuraden; Nifuraldezone; Nifuratel; Nifuratron; Nipurazil; Nipurimide; Nifurpynol; Nipurquinazole; Nipurthiazole; Nitrocycline; Nitrofurantoin; Nitromid; Norfloxacin; Novobiocin sodium; Offloxacin; Ormethoprim; Oxacillin sodium; Oxymonam; Oxymonam sodium; Oxolinic acid; Oxytetracycline; Oxytetracycline calcium; Oxytetracycline hydrochloride; Palmidicin; Parachlorophenol; Paulomycin; Pefloxacin; Pefloxacin mesylate; Phenamecillin; Penicillin G benzatin; Penicillin G potassium; Penicillin G procaine; Penicillin G sodium; Penicillin V; Penicillin V benzatin; Penicillin V hydravamin; Penicillin V potassium; Pentagedon sodium; Phenyl aminosalicylate; Piperacillin sodium; Pirbenicillin sodium; Pyridycillin sodium; Pyrimycin hydrochloride; Pibampicillin hydrochloride; Pibampicillin pamoate; Pibampicillin probenate; Polymyxin B sulphate; Porphyromycin; Propicacin; Pyrazinamide; Pyrithione zinc; Quindecamine acetate; Quinupristin; Racefenicol; Lamoplanin; Ranimycin; Lelomycin; Lepromycin; Lipabutin; Rifamethane; Lipamexyl; Lipamide; Rifampin; Ripapentin; Rifaximin; Lolitetracycline; Rolitetracycline nitrate; Rosaramycin; Rosaramycin butyrate; Rosaramycin propionate; Rosaramycin sodium phosphate; Rosaramycin stearate; Roxosacin; Loxarson; Roxytromycin; Acid cyclins; Sanpetrinem sodium; Sarmoxicillin; Sarpicillin; Scopafungin; Sisomycin; Sisomycin sulfate; Sparfloxacin; Spectinomycin hydrochloride; Spiramycin; Stalymycin hydrochloride; Stepymycin; Streptomycin sulfate; Streptonicozides; Sulfabenz; Sulfabenzamide; Sulfacetamide; Sulfacetamide sodium; Sulfacithin; Sulfadiazine; Sulfadiazine sodium; Sulfadoxin; Sulfalene; Sulfamerazine; Sulfa parameters; Sulfamethazine; Sulfamethazole; Sulfamethoxazole; Sulfamonomoxine; Sulfamoxol; Sulfanilate zinc; Sulfanitran; Sulfasalazine; Sulfasomiazole; Sulfatiazoles; Sulfazamet; Sulfisoxazole; Sulfisoxazole acetyl; Sulfisoxazole diolamine; Sulfomicin; Sulofenem; Sulfamicillin; Pure silinic sodium; Talampicillin hydrochloride; Teicoplanin; Temafloxacin hydrochloride; Temocillin; Tetracycline; Tetracycline hydrochloride; Tetracycline phosphate complexes; Tetroxoprim; Thiamphenicol; Thifencillin potassium; Ticarcillin cresyl sodium; Ticarcillin disodium; Ticarcillin monosodium; Ticlatone; Thionium chloride; Tobramycin; Tobramycin sulfate; Tosufloxacin; Trimetapririm; Trimetaprim sulfate; Trisulfyapyrimidine; Troleandomycin; Tropectomycin sulfate; Tyrotricin; Vancomycin; Vancomycin hydrochloride; Virginia mycin; And zorbamycin.
[255] Antiviral agents are compounds that prevent cellular infection by a virus or replication of a virus in a cell. Antiviral drugs are much less numerous than antibacterial drugs because the process of viral replication is closely related to DNA replication in host cells, and non-specific antiviral agents are often toxic to the host. There are several stages in the process of viral infection that can be blocked or inhibited by antiviral agents. These steps include the steps of attaching the virus to the host cell (immunoglobulin or binding peptide), uncoating the virus (eg amantadine), synthesizing or translating the viral mRNA (eg interferon), virus Replication steps of RNA or DNA (eg nucleoside analogs), maturation of new viral proteins (eg protease inhibitors), and budding and release of new viruses.
[256] Nucleotide analogs are synthetic compounds that are similar to nucleotides but retain the incompleteness of abnormal deoxyribose or ribose groups. If nucleotide analogs are present in the cell, they are phosphorylated and produce triphosphates that compete with normal nucleotides for incorporation into viral DNA or RNA. When the triphosphate form of the nucleotide analogues is incorporated into the extending nucleic acid chains, the analogues irreversibly bind the viral polymerase to terminate chain extension. [0024] Nucleotide analogues include acyclovir (herpes simplex virus and Used for the treatment of varicella-zoster virus), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial virus), didide Oxyinosine, dideoxycitadine, and zidovudine (azidothymidine), including but not limited to.
[257] Inteferon is a cytokine secreted by virus infected cells and immune cells. Interferons act by binding to specific receptors on cells adjacent to infected cells and cause changes in the cells that protect the cells from infection by the virus. α- and β-inteferons also induce expression of class I and class II MHC molecules on the surface of infected cells for recognition of host immune cells, thereby increasing antigen presentation. α- and β-inteferons are available in recombinant form and are useful for the treatment of chronic hepatitis B and C infections. At doses effective for anti-viral therapy, interferon has serious side effects such as fever, discomfort and weight loss.
[258] Immunoglobulin therapy is used for the prevention of viral infections. Immunoglobulin treatment for viral infections is distinct from viral infections, rather than because viral infections are antigen-specific, but immunoglobulins bind to extracellular virions and attach to cells that are susceptible to virus infection. This is because it prevents them from entering. This therapy is useful for preventing viral infections during the time the antibody is present in the host. In general, there are two types of immunoglobulin therapies: conventional immunoglobulin therapies and hyper-immunoglobulin therapies. Conventional immunoglobulin therapeutics utilize pooled antibody products prepared from the serum of normal blood donors. This pooled product includes low titers of antibodies against a wide range of human viruses, such as hepatitis A virus, parvovirus, enterovirus (particularly in newborns). Hyper-immunoglobulin therapy utilizes antibodies prepared from the sera of individuals with high titers of antibodies to certain viruses. This antibody is then used for the particular virus. Examples of hyper-immunoglobulins include zoster immunoglobulin (useful for the prevention of varicella in immune-damaged children and newborns), human rabies immunoglobulin (useful for post-exposure prevention of rabies in animals) Hepatitis B immunoglobulin (particularly useful for the prevention of hepatitis B virus in a subject exposed to the virus), and RSV immunoglobulin (useful for the treatment of respiratory syncitial virus infection).
[259] Another type of immunoglobulin therapy is active immunization. This includes administration of antibodies or antibody fragments to viral surface proteins. Two types of vaccines available for active immunization of hepatitis B include serum-derived hepatitis B antibodies and recombinant hepatitis B antibodies. Both are made from HBsAg. Antibodies are given in three doses to subjects at high risk of being infected with hepatitis B virus, such as healthcare workers, sex partners of chronic carriers, and infants.
[260] Thus, antiviral agents useful in the present invention include, but are not limited to, immunoglobulins, amantadine, interferon, nucleoside analogs and protease inhibitors. Specific examples of antiviral agents include acemanane, acyclovir; Acyclovir sodium; Adefovir; Allobudine; Albircept sudotox; Amantadine hydrochloride; Aranotin; Aryldon; Atevirdine mesylate; Abiridine; Sidofovir; Sifamphyline; Cytarabine hydrochloride; Delavirdine mesylate; Descyclovir; Didanosine; Disoxalyl; Edoxsudine; Enbiladen; Enviroxime; Famciclovir; Pamotin; Hydrochloride; Piacitabine; Pialuridine; Fosallylate; Foscarnet sodium; Phosphornet sodium; Strong cyclovir; Strong cyclovir sodium; Idocuridine; Ketoxal; Lamivudine; Lobukavir; Memotin hydrochloride; Metisosazone; Nevirapine; Pencyclovir; Fatigue; Ribavirin; Rimantadine hydrochloride; Saquinavier mesylate; Somantadine hydrochloride; Soribudine; Statolon; Stavudine; Tyloron hydrochloride; Trifluidine; Valacyclovir hydrochloride; Vidarabine; Vidarabine phosphate; Vidarabine sodium phosphate; Though Shim; Salcitabine; Zidovudine and aphids are included, but are not limited to these.
[261] Antifungal agents are useful for the treatment and prevention of infectious fungi. Antifungal agents are sometimes classified by their mechanism of action. Some antifungal agents act as cell wall inhibitors by inhibiting glucose synthase. These include but are not limited to basiungin / ECB. Other antifungal agents act to destabilize membrane integrity. These include imidazoles such as clotrimazole, sertaconazole, fluconazole, itraconazole, ketoconazole, myconazole and barleyconacol as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimycin , UK 292, butenapine, and terbinapine. Other antifungal agents act to break down chitin (eg, chitinase) or immunosuppressant (501 cream). Some examples of commercially available materials are shown in Table B below.
[262]
[263] Thus, antifungal agents useful in the present invention include imidazole, FK 463, amphotericin B, BAY 38-9502, MK 991, pramidicin, UK 292, butenapine, chitinase, 501 cream, acrisocin; Ambruticin; Amorolpine, amphotericin B; Azaconazole; Azaserine; Bashfungin; Biponazole; Biphenamine hydrochloride; Bispyrithione magsulpex; Butoconazole nitrate; Calcium undecylenate; Candicidine; Carball-fucinin; Chlordantoin; Cyclopyrox; Cyclopyrox olamine; Xylofungin; Cyscoazole; Clotrimazole; Cuprimycin; Denofungin; Dipyrithione; Doconazole; Echonasol; Echonasol nitrate; Enylconazole; Etona nitrate; Penticonazole nitrate; Pyripine; Fluconazole; Flucitosine; punzymycin; Griseofulvin; Hamycin; Isoconazole; Itraconazole; Colorfungin; Ketoconazole; Lomofungin; Lidimicin; Mepartricin; Myconazole; Myconazole nitrate; Monensin; Monensin sodium; Naphthypine hydrochloride; Neomycin undecylenate; Nifuratel; Nipurmeron; Nitralamine hydrochloride; Nystatin; Octanoic acid; Orconazole nitrate; Oxyconazole nitrate; Oxyfungin hydrochloride; Parconazole hydrochloride; Particin; Potassium iodide; Prolonol; Pyrithione zinc; Pyrronitrin; Rutamycin; Sanguinarium chloride; Saperconazole; Scopafungin; Selenium sulfide; Cinefungin; Sulfonazole nitrate; Terbinapine; Terconazole; Thiram; Ticlatone; Thioconazole; Tocyclate; Tolindate; Tolnaftate; Triacetin; Triafungin; Undecylenic acid; Bilidofulvin; Zinc undecylenate; And zinoconazole hydrochloride, including but not limited to.
[264] Immunostimulatory nucleic acids can be combined with other therapeutic agents, such as adjuvants, to increase the immune response. Immunostimulatory nucleic acids and other therapeutic agents may be administered simultaneously or sequentially. If different therapeutic agents are administered simultaneously, they may be administered in the same formulation or in separate formulations, but at the same time. If the administration of the other therapeutic agent and the immunostimulatory nucleic acid is temporarily separated, the other therapeutic agent is administered sequentially with each other along with the immunostimulatory nucleic acid. The time difference between the administration of these compounds may be several minutes or longer. Other therapeutic agents include, but are not limited to, adjuvants, cytokines, antibodies, antigens, and the like.
[265] Immunostimulatory nucleic acids are useful as adjuvants to induce a systemic immune response. Thus, delivery to a subject exposed to an antigen can result in an enhanced immune response against this antigen.
[266] Compositions of the invention can also be administered with non-nucleic acid adjuvant in addition to immunostimulatory nucleic acids. Non-nucleic acid adjuvant is any molecule or compound other than the immunostimulatory nucleic acid molecules described herein that can stimulate a humoral and / or cellular immune response. Non-nucleic acid adjuvant includes, for example, an adjuvant that produces a depo effect, an immunostimulatory adjuvant, and an adjuvant that produces a depot effect and stimulates the immune system.
[267] As used herein, an adjuvant that produces a depot effect is an adjuvant that slowly releases the antigen into the body to prolong the exposure of immune cells to the antigen. Auxiliaries of this kind include alum (eg, aluminum hydroxide, aluminum phosphate); Or emulsion-based compositions comprising mineral oils, non-mineral oils, water-in-oil-in-oil-in-oil emulsions, oil-in-water emulsions, for example, Monticide auxiliaries of the Seppic ISA family (e.g. Montanide ISA) 720, AirLiquide, Paris, France); MF-59 (water squalene emulsion stabilized with Span 85 and Tween 80; Chiron Corporation, Emeryville, Calif.); And PROVAX (oil-in-water emulsions containing stabilized detergents and mineral-forming materials; IDEC Pharmaceuticals Corporation, San Diego, Calif.).
[268] Immunostimulatory adjuvants are adjuvants that cause activation of cells of the immune system. This adjuvant can, for example, allow immune cells to produce and secrete cytokines. As a supplement of this kind, cue. Purified saponins from the bark of Q. saponaria tree, for example QS21 (glycolipids eluting at the 21st peak in HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, Mass.); Poly [di (carboxylaytophenoxy) phosphazene (PCPP polymer; Virus Research Institute, USA); Derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Resealch, Inc., Hamilton, MT), muramil dipeptides (MDP; Ribi) and threonyl-muramil dipeptides (t- MDP; Ribi); OM-174 (glucosamine disaccharide associated with lipid A; OM Pharma SA, Meyrin, Switzerland); And Leishmania extending factor (purified Laishmania protein; Corixa CoTporation, Seattle, WA).
[269] Adjuvants that produce a depot effect and stimulate the immune system are compounds with both of the above-mentioned functions. Adjuvant of this kind include ISCOMS (an immunostimulatory complex that forms virus-sized particles with mixed saponins, pores that contain lipids and can retain antigens; CSL, Melboume, Australia); SB-AS2 (SmithKline Beecham Adjuvant System # 2, an oil-in-water emulsion containing MPL and QS21: SmithKline Beecham Biologicals [SBB], Rixensart, Belgium); SB-AS4 (SmithKline Beecham Adjuvant System # 4 containing alum and MPL; SBB, Belgium); Non-ionic block copolymers that form micelles, such as CRL 1005 (these include straight chains of hydrophobic polyoxypropylene flanked by polyoxyethylene chains; Vaxcel, Inc., Norcross, GA); And oil-in-water emulsions containing Syntex coagent (SAF, Tween 80 and nonionic block copolymers; Syntex Chemicals, Inc., Boulder, CO).
[270] Immunostimulatory nucleic acids are also useful as mucosal aids. Both systemic and mucosal immunity have already been found to be induced by mucosal delivery of CpG nucleic acids. Systemic immunity induced in response to CpG nucleic acids included both humoral and cell-mediated responses to specific antigens that, when administered alone to the mucosa, could not induce systemic immunity. In addition, both CpG nucleic acid and cholera toxin (CT, mucosal adjuvant inducing Th2-like responses) induced CTL. This is surprising because for systemic immunization the presence of Th24-like antibodies is usually associated with a lack of CTL (Schirmbeck et aL, 1995). Based on the results presented herein, it is expected that immunostimulatory nucleic acids act in a similar manner.
[271] In addition, immunostimulatory nucleic acids induce mucosal responses at both local (eg lung) and distant (eg lower digestive tract) mucosal sites. Significant levels of IgA antibodies are induced at distant mucosal sites by immunostimulatory nucleic acids. CT is generally thought to be a very effective mucosal adjuvant. As reported in prior literature (Snider 1995), CT mainly induces the IgG ₁ isotype of the antibody, indicating a Th2-type response. In contrast, immunostimulatory nucleic acids are other Th1s that induce IgG2a antibodies predominantly, especially after antigen stimulation or in combination with both adjuvants. Th1-type antibodies generally have better neutralizing capacity and are also very undesirable because the Th2 response in the lung is associated with asthma (Kay, 1996, Hogg, 1997). Thus, the use of immunostimulatory nucleic acids as immunoadjuvant has the advantage that cannot be achieved with other mucosal adjuvants. The immunostimulatory nucleic acids of the present invention are also useful as mucosal aids for inducing both systemic and mucosal immune responses.
[272] Mucosal adjuvants, referred to as non-nucleic acid mucosal adjuvants, may also be administered with immunostimulatory nucleic acids. Non-nucleic acid mucosal adjuvants as used herein are adjuvants other than immunostimulatory nucleic acids that, when administered to the mucosal surface in association with an antigen, can induce an immune response of the mucosa in a subject. Mucosal adjuvants include bacterial toxins such as cholera toxin (CT), CT B subunit (CTB) (Wu et al., 1998, Tochikubo et al., 1998); CTD53 (Val to Asp) (Fontana et al., 1995); CTK97 (Val to Lys) (Fontana et al., 1995); CTK104 (Tyr to Lys) (Fontana et al., 1995); CTD53W63 (Val to Asp, Ser to Lys) (Fontana et al., 1995); CTH54 (Arg to His) (Fontana et al., 1995); CTN107 (His to Asn) (Fontana et al., 1995); CTE114 (Ser to Glu) (Fontana et al., 1995); CTE112K (Glu to Lys) (Yamamoto et al., 1997a); CTS61F (Ser to Phe) (Yamamoto et al., 1997a, 1997b); CTS 106 (Pro to Lys) (Douce et al., 1997, Fontana et al., 1995); And CT derivatives including, but not limited to, CTK63 (Ser to Lys) (Douce et al., 1997, Fontana et al., 1995), Zonula occludens toxin, zot, Ischia coli ( Escherichia coli) heat-labile enterotoxin, labile toxin (LT), LT B subunit (LTB) (Verweij et al., 1998); LT7K (Arg to Lys) (Komase et al., 1998, Douce et al., L995); LT61F (Ser to Phe) (Komase et al., 1998); LT112K (Glu to Lys) (Komase et al., 1998); LT118E (Gly to Glu) (Komase et al., 1998); LT146E (Arg to Glu) (Komase et al., 1998); LT192G (Arg to Gly) (Komase et al., 1998); LTK63 (Ser to Lys) (Marchetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et al., 1996); And LT derivatives, including but not limited to LTR72 (Ala to Arg) (Giuliani et al., 1998), PT-9K / 129G (Roberts et al., 1995, Cropley et al., 1995) Pertussis toxin, PT (Lycke et al., 1992, Spangler BD, 1992, Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et al., 1995); Toxin derivatives (see below) (Holmgren et al., 1993, Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements, 1999); Lipid A derivatives (e.g., monophosphoryl lipid A, MPL) (Sasaki et al., 1998, Vancott et al., 1998; muramyl dipeptide (MDP) derivatives (Fukushima et al., 1996, Ogawa et al) , 1989, Michalek et al., 1983, Morisaki et al., 1983; bacterial outer membrane proteins (eg, outer surface proteins of Borrelia burgdorferi (OspA) lipoproteins, outer membrane proteins of Neisseria meningitidis) (Marinaro et. al., 1999, Van de Verg et al., 1996); oil-in-water emulsions (e.g., NlF59) (Barchfield et al., 1999, Verschoor et al., 1999, O'Hagan, 1998); aluminum salts ( Isaka et al., 1998, 1999); and saponins (e.g., QS21) Aquila Biopharmaceuticals, Inc., Worster, MA (Sasaki et al., L998, MacNeal et al., 1998), ISCOMS, MF-59 (Aqua squalene emulsion stabilized with Span 85 and Tween 80; Chiron Corporation, Emeryville, CA); Septan ISA family of Montanide supplements (eg, Montanide ISA 720; AirLiquide, Paris, France); PROVAX (oil-in-water emulsion containing stabilized detergent and micelle-forming material; IDEC Pharmaceuticals Corporation, San Diego, Calif.); Syntext adjuvant (SAF; Syntex Chemicals, Inc., Boulder, CO); Poly [di (carboxylaytophenoxy) phosphazene (PCPP polymer; Virus Research Institute, USA) and Leishmania elongation factor (Corixa Corporation, Seattle, WA), including but not limited to.
[273] The immune response can also be expressed by cytokines (Bueler & Mulligan, 1996; Chow et al, 1997; Geissler et al., 1997; Iwasaki et al, 1997; Kim et al, 1997) or B-7 costimulatory molecules (Owasaki et al, 1997; Tsuji et al, 1997) may be induced or increased by co-administration with immunostimulatory nucleic acids or by co-linear expression. Cytokines can be administered directly with an immunostimulatory nucleic acid or in the form of a nucleic acid vector encoding the cytokine so that the cytokine can be expressed in vivo. In one embodiment, the cytokine is administered in the form of a plasmid expression vector. The term cytokine acts as a humoral modulator at nano to picomolar concentrations and is used as a generic name for various groups of soluble proteins and peptides that regulate the functional activity of each cell or tissue under normal or pathogenic conditions. These proteins also directly mediate interactions between cells and regulate the responses that occur in the extracellular environment. Examples of cytokines include IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, granulocyte-macrophage Colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interferon-γ (γ-IFN), IFN-α, tumor necrosis factor (TNF), TGF-β, FLT-3 ligand, and CD40 ligands include, but are not limited to.
[274] Cytokines play a role in directing the T cell response. Helper (CD4 +) T cells aggregate mammalian immune responses through the production of soluble factors that act on other T cells as well as other immune system cells. Most mature CD4 + T helper cells express two cytokine profiles, either Th1 or Th2. Th1 subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class conversion to IgG2a. Th2 subsets induce humoral immunity by activating B cells, promoting antibody production, and inducing class conversion to IgG ₁ and IgE. In some embodiments, it is preferred that the cytokine is a Th1 cytokine.
[275] Nucleic acids are also useful for redirecting an immune response from a Th2 immune response to a Th1 immune response. Redirection of the immune response from Th2 to the Th1 immune response can be assessed by measuring the levels of cytokines produced in response to nucleic acids (eg, monocytes and other cells can be assessed by Th1 cytokines (IL-12, IFN). to produce -γ and GM-CSF). Redirecting or rebalancing the immune response from Th2 to Th1 response is particularly useful in the treatment or prevention of asthma. For example, an amount effective for treating asthma is an amount useful for redirecting a Th2 type immune response associated with asthma to a Th1 type response. Th2 cytokines, especially IL-4 and IL-5, are increased in the airways of asthmatic patients. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotype switching, eosinophil chemotaxis and activation, and mast cell growth. Th1 cytokines, particularly IFN-γ and IL-12, form Th2 clones and Th2 cytokines. It is possible to suppress the production of chine. The immunostimulatory nucleic acids of the present invention cause an increase in Th1 cytokines that aid in rebalancing the immune system and prevent or reduce the adverse effects primarily associated with Th2 immune responses.
[276] Nucleic acids are also useful for improving the survival, differentiation, activation and maturation of dendritic cells. Immunostimulatory nucleic acids have the unique ability to promote the survival, differentiation, activation and maturation of dendritic cells. Progenitor cells of dendritic cells isolated from blood by immunomagnetic cell sorting show morphological and functional characteristics of dendritic cells during 2 days of incubation with GM-CSF. In the absence of GM-CSF, these cells undergo apoptosis. Immunostimulatory nucleic acids are superior to GM-CSF in promoting survival and differentiation of dendritic cells (MHC II expression, cell size, granularity). Immunostimulatory nucleic acids also induce maturation of dendritic cells. Dendritic cells use immunostimulatory nucleic acids because dendritic cells form a link between the innate and acquired immune systems not only by presenting antigens, but also through expression of pattern recognition receptors that detect microbial molecules such as LPS in their local environment. The ability to activate the gene supports the use of such immunostimulatory nucleic acid based strategies for in vivo and ex vivo immunotherapy for diseases such as cancer and allergic or infectious diseases. Immunostimulatory nucleic acids are also useful for activating and inducing maturation of dendritic cells.
[277] Immunostimulatory nucleic acids also increase the lytic activity of natural killer cells and cytotoxicity (ADCC) of antibody dependent cells. Immunostimulatory nucleic acids can be used in conjunction with antibodies specific for cellular targets, such as cancer cells, to perform ADCC. When an immunostimulatory nucleic acid is administered to a subject together with an antibody, the subject's immune system is induced to kill tumor cells. Antibodies useful in the ADCC method include antibodies that interact with cells in the body. Many such such antibodies specific for cellular targets are known in the art and many are commercially available. Examples of such antibodies are listed below among the cancer immunotherapy classes.
[278] Immunostimulatory nucleic acids can also be administered with anticancer agents. Anticancer therapies include cancer drugs, radiation and surgical methods. As used herein, "cancer drug" means a substance that is administered to a subject for the treatment of cancer. As used herein, “treating cancer” includes preventing cancer development, reducing cancer symptoms, and / or inhibiting the growth of formed cancer. In another aspect, the cancer drug is administered to a subject at risk for cancer for the purpose of reducing the risk of cancer. Various types of drugs for the treatment of cancer are described herein. For the purposes of this specification, cancer therapeutic drugs are classified as chemotherapeutic agents, immunotherapeutics, cancer vaccines, hormonal therapies, and biological response modifiers.
[279] As used herein, "cancer drug" means a substance that is administered to a subject for the treatment of cancer. As used herein, “treating cancer” includes preventing cancer development, reducing cancer symptoms, and / or inhibiting the growth of formed cancer. In another aspect, the cancer drug is administered to a subject at risk for cancer for the purpose of reducing the risk of cancer. Various types of drugs for the treatment of cancer are described herein. For the purposes of this specification, cancer therapeutic drugs are classified as chemotherapeutic agents, immunotherapeutics, cancer vaccines, hormonal therapies, and biological response modifiers. In addition, the methods of the present invention include the use of one or more cancer therapeutic agents with immunostimulatory nucleic acids. For example, if desired, immunostimulatory nucleic acids can be administered with both chemotherapeutic and immunotherapeutic agents. Alternatively, the cancer therapeutic drug may include an immunotherapy agent and a cancer vaccine, or a chemotherapeutic agent and a cancer vaccine, or both a chemotherapeutic agent, an immunotherapy agent and a cancer vaccine, and may be used to treat a subject having cancer or at risk of developing cancer. Is administered.
[280] Cancer drugs work in a variety of ways. Some cancer therapeutic agents act to target physiological mechanisms specific for tumor cells. Examples include targeting specific genes that are mutated in cancer and their gene products (ie, predominantly proteins). Such genes include oncogenes (eg Ras, Her2, bcl-2), tumor suppressor genes (eg EGF, p53, Rb), and cell cycle targets (eg CDK4, p21, telomera) 1) include, but are not limited to. Alternatively, cancer therapeutic drugs may target signaling pathways and molecular mechanisms that are modified in cancer cells. Targeting cancer cells through epitopes expressed on the surface of cancer cells is accomplished by the use of monoclonal antibodies. This latter type of cancer drug is generally referred to herein as an immunotherapeutic.
[281] Other cancer therapeutic drugs target cells other than cancer cells. For example, some drugs initiate the immune system to attack tumor cells (ie cancer vaccines). Another therapeutic agent, called angiogenesis inhibitors, functions to attack solid tumors that are supplied to the blood. Since most malignant cancers can metastasize (i.e., spread to tissues far from the primary tumor site to form a second tumor), drugs that interfere with this metastasis are also useful for the treatment of cancer. Angiogenesis mediators include several members of the basic FGF, VEGF, angiopoietin, angiostatin, endostatin, TNFα, TNP-470, thrombospondin-1, platelet factor 4, CAI, and integrin protein families. One category of therapeutic agents of this type are metalloproteinase inhibitors that inhibit enzymes used by cancer cells that are present in the primary tumor site and are released into other tissues.
[282] Some cancer cells are antigenic and thus can be targeted by the immune system. In one aspect, the co-administration of immunostimulatory nucleic acids with cancer therapeutic agents, particularly drugs classified as cancer immunotherapeutic agents, is useful for stimulating specific immune responses against cancer antigens. As used herein, a "cancer antigen" is a compound such as a peptide capable of stimulating an immune response when expressed in MHC molecules on the surface of an antigen presenting cell in combination with a tumor cell or the surface of a cancer cell. Cancer antigens, such as those present in cancer vaccines or used to prepare cancer immunotherapeutic agents, include methods described in Cohen, et al., 1994, Cancer Research, 54: 1055, partial purification of antigens using recombinant techniques, or known Can be prepared from crude extract of cancer cells by de novo synthesis of the antigen. Cancer antigens can be used in the form of immunogenic portions of certain antigens, and in some cases whole cells or tumor masses can be used as antigens. Such antigens may be isolated or prepared recombinantly or by any other method known in the art.
[283] The theory of immune supervision is that the main function of the immune system is to detect and remove neoplastic cells before tumor formation. The basic principle of this theory is that cancer cells differ in tumorigenicity from tumor cells and thus induce an immune response similar to the one that causes rejection of an immunologically inappropriate allograft. Studies have shown that tumor cells differ qualitatively or quantitatively in their antigen expression. For example, a "tumor-specific antigen" refers to an antigen that specifically binds tumor cells but not normal cells. Examples of tumor specific antigens are viral antigens of tumors induced by DNA or RNA viruses. "Tumor-associated" antigens are present in both tumor cells and normal cells, but in different amounts or forms within the tumor cells. Examples of such antigens are fetal tumor antigens (eg fetal cancer antigens), differentiation antigens (eg T and Tn antigens), and oncogene products (eg HER / neu).
[284] Several types of cells have been identified that can kill tumor targets in vitro and in vivo: natural killer cells (NK cells), cytolytic T lymphocytes (CTL), lymphokine-activated killer cells (LAK), and activation Macrophages. NK cells can kill tumor cells without prior sensitization to specific antigens, and this activity does not require the presence of class I antigens encoded by major histocompatibility complexes (MHCs) on target cells. NK cells are thought to be involved in the inhibition of early tumors and the inhibition of metastatic proliferation. Unlike NK cells, CTLs can kill tumor cells immediately after they are sensitized to the tumor antigen and when the target antigen is expressed on tumor cells expressing MHC class I. CTLs are thought to be effector cells in tumor rejection responses induced by transplanted tumors and DNA viruses. LAK cells are a subset of null lymphocytes that are different from the NK and CTL populations. When activated, activated macrophages can kill tumor cells in a manner that is neither antigen dependent nor MHC restricted. Activated macrophages are thought to slow the growth rate of tumors they penetrate. In vitro analysis confirmed other immune mechanisms such as antibody-dependent, cell-mediated cytotoxic responses, and lysis by antibodies and complement. However, this immune effector mechanism is believed to be less important in vivo than the function of NK, CTL, LAK and macrophages in vivo (for review see Peiessens, WF, and David, J., "Tumor Immunology", In Scientific American Medicine Vol. 2, Scientific American Books, NY, pp. 1-13, 1996).
[285] The goal of immunotherapy is to augment the subject's immune response against the formed tumor. One method of immunotherapy involves the use of an adjuvant. Auxiliary substances derived from microorganisms, for example Bacillus Calmette-Guerin, increase immune responses and strengthen tumor resistance in animals.
[286] An immunotherapeutic agent is in particular a therapeutic drug derived from an antibody or antibody fragment that binds to or recognizes a cancer antigen. As used herein, a cancer antigen is defined in a broad sense as an antigen expressed by cancer cells. Preferably, the antigen is expressed on the cell surface of cancer cells. Even more preferably, the antigen is not expressed by normal cells or at least at the same level as in cancer cells. Antibody immunotherapy agents bind to the cell surface of cancer cells to stimulate the internal immune system to attack cancer cells. Another method by which antibody-like therapeutics work is as a delivery system for specific targeting of toxic substances to cancer cells. Antibodies typically include lysine (eg, from castor beans), toxins such as calicheamicin and maytansinoids, radioactive isotopes such as iodine-131 and yttrium-90, chemotherapeutic agents (as described herein) Like), or biological response modifiers. In this way, toxic substances can be concentrated at the site of cancer, thereby minimizing non-specific toxicity to normal cells. In addition to using antibodies specific for cancer antigens, it is also useful in the present invention to bind antibodies that bind blood vessels, such as endothelial cells. This is because tumors that are generally solid rely on newly formed blood vessels to survive, so most tumors can enhance or stimulate the growth of new blood vessels. As a result, one strategy for many cancer therapeutic drugs is to attack the blood vessels supplying the tumor and / or the connective tissue (or stroma) that supports these blood vessels.
[287] Immunostimulatory nucleic acids can be used in combination with immunotherapeutic agents, such as monoclonal antibodies, for a long time through many mechanisms, including significant increases in ADCC (as described above), activation of natural killer (NK) cells, and increased IFNα levels. It can increase your viability. When used with monoclonal antibodies, the nucleic acid acts to reduce the dose of antibody required to achieve a biological result.
[288] Examples of cancer immunotherapeutic agents currently in use or under development are listed in Table C below.
[289]
[290]
[291]
[292]
[293] Another type of chemotherapeutic agent that may be used in accordance with the present invention is aminoglutetimide, asparaginase, busulfan, carboplatin, chlorrombucil, cytarabine HCl, dactinomycin, daunorubicin HCl, estradiol Phosphate sodium, etoposide (VP16-213), phloxuridine, fluorouracil (5-FU), flutamide, hydroxyurea (hydroxycarbamide), phosphamide, interferon Alfa-2a, Alfa-2b, leuprolide acetate (LHRH-releasing factor analog), lomustine (CCNU), mechloretamine HCl (nitrogen mustard), mercaptopurine, mesna, mitotan (o.p'-DDD), Mitoxantrone HCl, octreotide, plicamycin, procarbazine HCl, streptozosin, tamoxifen citrate, thioguanine, thiotepa, vinblastine sulphate, amsacrine (m-AMSA), azacytidine, erg Tropoietin, hexamethylmelamine (HMM), interleukin 2, mitoguazone (meth -GAG; methyl glyoxal bis-guanylhydrazone; MGBG), pentostatin (2'deoxycoformycin), semustine (methyl-CCNU), teniposide (VM-26) and vindesine sulfate Included.
[294] Cancer vaccines are therapeutic agents intended to stimulate an internal immune response against cancer cells. Currently produced vaccines primarily activate the humoral immune system (ie, antibody dependent immune response). Other vaccines currently under development focus on activating cell-mediated immune systems, including cytotoxic T lymphocytes, which can kill tumor cells. Cancer vaccines generally increase the presentation of cancer antigens to antigen presenting cells (eg, macrophages and dendritic cells) and / or other immune cells (eg, T cells, B cells, and NK cells). .
[295] Cancer vaccines can take one of several forms, as discussed above, but their purpose is to deliver cancer antigens and / or cancer related antigens to antigen presenting cells (APCs) to prevent internal processing of these antigens by APCs. For the final presentation of antigen presentation in MHC class I molecules on the cell surface. One form of cancer vaccine is a whole cell vaccine, a cancer cell sample that is removed from a subject, processed ex vivo, and then reintroduced into the subject as whole cells. Lysates of tumor cells can also be used as cancer vaccines to induce immune responses. Another form of cancer vaccine is a peptide vaccine using cancer-specific or cancer-related small molecules that activate T cells. Cancer-related proteins are proteins that are not exclusively expressed by cancer cells (ie other normal cells can also express these antigens). However, expression of cancer-associated antigens is generally consistently upregulated in certain types of cancer. Another form of cancer vaccine is a dendritic cell vaccine comprising whole dendritic cells exposed to cancer antigens or cancer-associated antigens in vitro. Lysates or membrane fractions of dendritic cells can also be used as cancer vaccines. Dendritic vaccines can directly activate antigen-presenting cells. Other cancer vaccines include ganglioside vaccines, heat-shock protein vaccines, viral and bacterial vaccines, and nucleic acid vaccines.
[296] Immunostimulatory nucleic acids are used in conjunction with cancer vaccines to enhance antigen-specific humoral and cell mediated immune responses in addition to activating NK cells and internal dendritic cells and increasing IFNα levels. This increase allows the same beneficial effects to be achieved with vaccines with reduced antigen doses. In some cases, cancer vaccines may be used, for example, with adjuvant as described above.
[297] As used herein, the terms "cancer antigen" and "tumor antigen" are interchangeable and refer to antigens that can be used to target cancer cells as they are differentially expressed by the cancer cells. Cancer antigens are potentially antigens that can clearly stimulate tumor-specific immune responses. Some of these antigens are not necessarily expressed but are encoded by normal cells. Such antigens can be characterized as not normally present in normal cells (eg, not expressed), expressed only in certain stages of differentiation, and transiently expressed as embryonic and fetal antigens. Other cancer antigens are encoded by variant cell genes, such as fusion protein genes resulting from oncogenes (eg, activated Ras oncogenes), inhibitory genes (eg, variant p53), internal deletions or chromosomal translocations. do. Another cancer antigen can be encoded by viral genes such as those carried on RNA and DNA tumor viruses.
[298] Other vaccines take the form of dendritic cells, which can be exposed to cancer antigens in vitro to process the antigens and express cancer antigens in MHC molecules on these cell surfaces for effective antigen presentation to other immune system cells. .
[299] Immunostimulatory nucleic acids are used in conjunction with cancer vaccines that are dendritic cells in one aspect of the invention. Dendritic cells are specialized antigen presenting cells. Dendritic cells form a link between the auditory and acquired immune systems through the presentation of antigens and the expression of pattern recognition receptors that detect microbial molecules such as LPS in their local environment. Dendritic cells internalize, process, and present soluble specific antigens exposed to these cells. Internalization and antigen presentation processes rapidly upregulate migration to lymphoid organs thought to be involved in the expression of major histocompatibility complex (MHC) and costimulatory molecules, the production of cytokines, and the activation of T cells.
[300] Table D lists various cancer vaccines currently in use or under development.
[301]
[302]
[303] As used herein, chemotherapeutic agents include all other forms of cancer therapeutic agents that do not fall under the category of immunotherapeutic or cancer vaccines. As used herein, chemotherapeutic agents include both chemical and biological materials. These substances act by inhibiting cellular activity, which cancer cells depend on for their continued survival. Categories of chemotherapeutic agents include alkylating agents / alkaloids, antimetabolic agents, hormones or hormone analogs, and various antitumor drugs. Most, if not all, of these substances are directly toxic to cancer cells and do not require immune stimulation. Combination chemotherapeutic and immunostimulatory nucleic acid administration increases the maximum tolerated dose of chemotherapeutic agent.
[304] Chemotherapeutic agents currently under development or used in clinical stages are shown in Table E below.
[305]
[306]
[307]
[308] In one embodiment, the methods of the invention use immunostimulatory nucleic acids as an alternative therapy for using IFNα therapy in the treatment of cancer. Currently, several treatment protocols require the use of IFNα. Since IFNα is produced after administration of some immunostimulatory nucleic acids, such nucleic acid can be used internally to produce IFNα.
[309] The invention also encompasses methods of using immunostimulatory nucleic acids to induce non-specific innate immune activation and broader resistance to infectious antigens. As used herein, the term antigen non-specific innate immune activation refers to the activation of immune cells other than B cells, for example NK cells, T cells or other immune cells that can respond in an antigen independent manner. Activation of a cell, or some combination of these cells. Because immune cells are active and initiated and respond to any penetrating compound or microorganism, a wide range of resistance to infectious antigens is induced. The cells need not be specifically initiated for a particular antigen. This is particularly useful in biological environments, and other environments described above, such as travelers.
[310] The stimulation index of certain immunostimulatory nucleic acids can be tested in various immune cell assays. Preferably, the stimulation index of immunostimulatory nucleic acids for B cell proliferation prioritizes US Pat. Nos. 08 / 386,063 and 08 / 960,774, filed February 7, 1995 and October 30, 1997, respectively. as it described in PCT Patent Application Publication No. claim according to PCT / US95 / 01570 (WO 96/02555 ) and such arc the PCT / US97 / 19791 (WO 98/18810 ) , which details the call, the rat ³ H uridine B Incorporating into cell culture and contacting with 20 μM of nucleic acid at 37 ° C. for 20 hours, pulsing with 1 μCi of ³ H uridine, harvesting after 4 hours, counting and measuring, at least about 5, preferably about At least 10, more preferably at least about 15, most preferably at least about 20. For in vivo use, it is important that, for example, immunostimulatory nucleic acids can effectively induce an immune response, eg antibody production.
[311] Immunostimulatory nucleic acids are effective in non-rodent vertebrates. Other immunostimulatory nucleic acids may cause optimal immune stimulation depending on the type of subject and the sequence of the immunostimulatory nucleic acid. In accordance with the present invention, many vertebrates have been found to respond to the same kind of immunostimulatory nucleic acids, sometimes referred to as human specific immunostimulatory nucleic acids. However, rodents respond to other nucleic acids. As shown herein, immunostimulatory nucleic acids that cause optimal stimulation in humans generally do not cause optimal stimulation in contrast to mice. However, immunostimulatory nucleic acids that cause optimal stimulation in humans often cause optimal stimulation in other animals, such as cattle, horses, sheep, and the like. Those skilled in the art can find the optimal immunostimulatory nucleic acid useful for a particular species of subject using conventional assays described herein and / or known in the art and the guidelines presented herein.
[312] Immunostimulatory nucleic acids can be administered directly to a subject or in conjunction with a nucleic acid delivery complex. Nucleic acid delivery complexes (eg, molecules that bind with high affinity to a targeting means (eg, a target cell (eg, B cell surface) and / or an increase in cell uptake by the target cell) (eg, Nucleic acid molecules bound by ionic or covalent bonds or protected internally). Examples of nucleic acid delivery complexes are recognized by sterols (eg cholesterol), lipids (eg cationic lipids, virosomes or liposomes), or target cell specific binding agents (eg target cell specific receptors). Nucleic acid) to which the ligand is attached. Preferred complexes are sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell. However, the complex can be cleaved under appropriate conditions within the cell such that the nucleic acid is released in functional form.
[313] DETAILED DESCRIPTION A delivery means or delivery tool for cleaving antigens and nucleic acids to a surface is described. Immunostimulatory nucleic acids, antigens, and / or other therapeutic agents may be administered alone (eg, in saline or buffer) or using any means of delivery in the art. For example, there are the following means of delivery: Cochleate (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOM (Mowat et al., 1993, Carlsson et al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Probiotic vectors (e.g., Salmonella, Escherichia coli, Bacillus calmate-guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (eg vaccinia, adenovirus, herpes simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., 1989); Nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (eg, carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium fluoride (Hashi et al., 1998); Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998). Other means of delivery are known to those skilled in the art, and some further examples of the discussion of the vectors are provided below.
[314] The term effective amount of an immunostimulatory nucleic acid means an amount necessary or sufficient to realize a desired biological effect. For example, an effective amount of immunostimulatory nucleic acid to induce mucosal immunity refers to the amount necessary to generate IgA in response to the antigen upon exposure to the antigen, while the amount necessary to induce systemic immunity refers to an antigen upon exposure to the antigen. Means the amount required to generate IgG in response. Incorporating the teachings provided herein, it is possible to select from a variety of active compounds and consider the efficacy, relative bioavailability, the weight of the patient, the degree of adverse side effects, and the preferred mode of administration, to treat a particular subject without causing substantial toxicity. You can design effective prophylactic or therapeutic treatments that work as a whole. The effective amount for any particular case may vary depending on factors such as the disease or condition to be treated, the particular immunostimulatory nucleic acid to be administered, the antigen, the size of the subject, or the depth of the disease or condition. One skilled in the art will be able to experimentally determine the effective amount of antigen for a particular immunostimulatory nucleic acid and / or other therapeutic agent without undue experimentation.
[315] Subject doses of the compounds described herein for mucosal or topical delivery are typically in the range of about 0.1 μg to 10 mg per dose, with the administration optionally being given daily, weekly, or monthly, and for any other time between them. Can be. More typically, mucosal or topical dosages are about 10 μg to 5 mg, most typically about 100 μg to 5 mg, most typically about 100 μg to 1 mg per dose, divided by 2 to day or week intervals. It can be administered four times. More typically, the dose of immune stimulant is 1 μg to 10 mg, most typically 10 μg to 1 mg, per day or weekly dose. Subject doses of a compound described herein, delivered with an antigen but not with other therapeutic agents, parenterally delivered to elicit an antigen-specific immune response are typically 5 to more than the mucosal dose effective amount of a vaccine adjuvant or immune stimulant. 10,000 times, more typically 10 to 1, OOO times, most typically 20 to 100 times higher. Dosages of compounds described herein that are delivered parenterally to induce an innate immune response, increase ADCC, or elicit an antigen specific immune response can be achieved by incorporating the immunostimulatory nucleic acid in combination with other therapeutic agents or in specialized delivery means. In the case of administration, it is usually about 0.1 μg to 10 mg per administration, and administration may be given daily, weekly or monthly, and any other time between them, as the case may be. More typically, parenteral dosages for this purpose are about 10 μg to 5 mg, most typically about 100 μg to 1 mg per dose, divided into two to four doses divided by day or week. However, in some embodiments parenteral dosages for this purpose can be used in the range of 5 to 10,000 times higher than the conventional dosages described above.
[316] For any compound described herein, the therapeutically effective amount can first be determined from an animal model. A therapeutically effective amount may also be CpG oligonucleotides tested in humans (starting clinical trials in humans), and compounds known to exhibit similar pharmaceutical activity, such as other mucosal adjuvant such as LT for mucosal or topical administration and vaccination Can be determined from human data for other antigens. Parenteral administration requires high doses. The dosage used can be adjusted based on the relative bioavailability and efficacy of the compound administered. It is easy for a person skilled in the art to adjust the dosage to achieve the maximum effect based on the methods described above and other methods well known in the art.
[317] The formulations of the present invention are administered in a pharmaceutically acceptable solution, which may typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, suitable carriers, adjuvants, and optionally other therapeutic ingredients.
[318] When used in therapy, an effective amount of immunostimulatory nucleic acid can be administered to a subject by any method of delivering the nucleic acid to the desired surface, eg, mucosa, systemically. Administration of the pharmaceutical compositions of the invention can be accomplished by any method known to those skilled in the art. Preferred routes of administration include, but are not limited to, oral, parenteral, intramuscular, intranasal, endocardial, inhalation, intraocular, intravaginal and rectal administration.
[319] For oral administration, the compounds (ie, immunostimulatory nucleic acids, antigens and other therapeutic agents) can be readily formulated by combining the active compounds with pharmaceutically acceptable carriers known in the art. For oral use by the treated subject, such carriers may allow the compounds of the invention to be formulated into tablets, pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions, and the like. Pharmaceutical formulations for oral use can be obtained as solid excipients, optionally by grinding the resulting mixture, optionally adding the appropriate adjuvant and then processing the granule mixture to obtain a tablet or dragee core. Suitable excipients include, in particular, sugars, including sucrose, mannitol, sorbitol; For example corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methyl cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP) Fillers such as cellulose preparations. If desired, disintegrants such as crosslinked polyvinyl pyrrolidone, agar, or alginic acid or salts thereof, such as sodium alginate can be added. Optionally, oral formulations may be formulated in saline or buffer to neutralize the acidic state therein or administered without any carrier.
[320] Provide a coating suitable for dragee cores. For this purpose, concentrated sugar solutions can be used, which optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and / or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. can do. Dyestuffs or pigments may be added to tablets or dragee coatings for identification or to characterize various combinations of active compound dosages.
[321] Pharmaceutical preparations that can be used orally include gelatin push-fit capsules, as well as gelatin and plasticizers, such as soft sealing capsules of glycerol or sorbitol. The push-fit capsules may contain the active ingredient in admixture with fillers such as lactose, binders such as starch, and / or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres are well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
[322] For oral administration, the compositions may be in the form of tablets or lozenges formulated in conventional manner.
[323] For administration by inhalation, the compounds used according to the invention are pressurized using suitable propellants, for example dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be delivered conveniently from the supplied pack in aerosol spray providing form or nebulizer form. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. For use in an inhaler or insufflator, for example, capsules and cartridges of gelatin can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch.
[324] Compounds that need to be delivered systemically can be formulated for parenteral administration by injection, eg, by pill injection or continuous infusion. Injectable preparations may be presented in unit dosage form, eg, in ampoules, or in multi-dose containers, with an added preservative. The compositions may take the form of suspensions, solutions or emulsions in oils or aqueous vehicles and may contain formulating materials such as suspending agents, stabilizers and / or dispersants.
[325] Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. In addition, suspensions of the active compounds can be prepared as suitable oil injection suspensions. Suitable lipocompatible solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, for example sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may contain suitable stabilizers or materials that increase the solubility of the compound to allow for the preparation of highly concentrated solutions.
[326] Alternatively, the active compound may be in powder form for use in a vehicle suitable for use, eg, sterile pyrogen-free water.
[327] The compounds may be formulated in rectal or vaginal compositions, for example suppositories, or retention enemas containing conventional suppository bases such as, for example, cocoa butter or other glycerides.
[328] In addition to the formulations described above, the compounds may also be formulated into accumulation formulations. Such long acting preparations may be formulated with suitable polymeric or hydrophobic materials (eg as emulsions in acceptable oils) or ion exchange resins, or as less soluble derivatives such as, for example, less soluble salts.
[329] The pharmaceutical composition may also comprise a suitable solid or gel carrier or excipient. Examples of such carriers or excipients include, but are not limited to, polymers such as calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polyethylene glycols.
[330] Suitable liquid or solid pharmaceutical formulation forms include, for example, inhaled aqueous or saline solutions, microencapsulated forms, cocleated forms, coated on fine gold particles, forms contained in liposomes, spray aerosol forms, Pellets that are implanted into the skin, or dried on sharp objects that are scratched into the skin. Pharmaceutical compositions also include granules, powders, tablets, coated tablets, (fine) capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations which prolong the release of the active compound, and include excipients and additives and / or Adjuvants such as disintegrants, binders, coatings, increasing agents, lubricants, flavoring agents, sweetening agents or solubilizing agents are commonly used as described above. Pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a schematic review of drug delivery methods, see Langer, Science 249: 1527-1533, 1990, which is incorporated herein by reference.
[331] Immunostimulatory nucleic acids, optionally other therapeutic agents, and / or antigens may be administered on their own (knit) or in pharmaceutically acceptable salt form. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can also conventionally be used to prepare their pharmaceutically acceptable salts. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, malic acid, acetic acid, salicylic acid, p-toluene sulfonic acid, tartaric acid, citric acid, methanesulfonic acid, formic acid, malonic acid , Succinic acid, naphthalene-2-sulfonic acid, and benzenesulfonic acid. Such salts may be prepared as alkali metal or alkaline earth metal salts, for example sodium, potassium or calcium salts of carboxylic acid groups.
[332] Suitable buffers include the following: acetic acid and salts thereof (1-27% w / v); Citric acid and its salts (1-37% w / v); Boric acid and salts thereof (0.5-2.5% w / v); And phosphoric acid and salts thereof (0.8-2% w / v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w / v); Chlorobutanol (0.3-0.9% w / v); Parabens (0.01-0.25% w / v) and thimerosal (0.004-0.02% w / v).
[333] Pharmaceutical compositions of the invention contain an effective amount of an immunostimulatory nucleic acid, and optionally an antigen, and / or optionally other therapeutic agent contained in a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating materials suitable for administration to humans or other vertebrates. The term carrier means a natural or synthetic organic or inorganic ingredient in which the active ingredient is combined to facilitate administration. The components of the pharmaceutical composition may also be mixed with one another of the compounds of the present invention in such a way that there are no interactions that substantially impair the desired drug efficacy.
[334] Useful immunostimulatory nucleic acids of the invention can be delivered in admixture with other adjuvants, other therapeutic agents, or antigens. The mixture may consist of several adjuvants in addition to immunostimulatory nucleic acids or several antigens or other therapeutic agents.
[335] Various routes of administration are available. The specific manner chosen will of course depend on the particular adjuvant or antigen selected, the particular condition to be treated and the dosage required for the efficacy of the treatment. The methods of the present invention may generally be carried out using any medically acceptable mode of administration, which means any way of displaying an effective level of immune response that does not cause clinically unacceptable adverse effects. Preferred modes of administration are described above.
[336] The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of mixing the compound with the carrier which constitutes one or more additional ingredients. Generally, the composition is prepared by mixing the compound uniformly and well with the liquid carrier, finely divided solid carrier, or both, and then molding the product if necessary. Liquid dosage units are vials or ampoules. Solid dosage units are tablets, capsules and suppositories. When treating a subject, different dosages may be necessary, depending on the activity of the compound, the mode of administration, the purpose of immunization (ie, prevention or treatment), the nature and depth of the disease, and the age and weight of the subject. A given amount of administration can be performed in the form of individual dosage units or in both smaller dosage units. To stimulate antigen-specific responses it is common to administer multiple doses at specific intervals of weeks or months.
[337] Other delivery systems may include release over time, delayed release or sustained release delivery systems. Such a system can avoid repeated administration of the compound, increasing the convenience for the patient and the physician. Many types of release delivery systems are available and are known to those skilled in the art. Examples include polymer based systems such as poly (lactide-glycosides), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. do. Microcapsules of such polymers containing drugs are described, for example, in US Pat. No. 5,075,109. The delivery system also includes the following non-polymeric systems: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-, di- and tri-glycerides; Hydrogel release systems; Silastic systems; Peptide-based systems; Wax coatings; Compressed tablets using conventional binders and excipients; And partially fused implants and the like. Specific examples include, but are not limited to, the following: (a) The material of the present invention is included in a form in a matrix as described in US Pat. Nos. 4,452,775, 4,675,189, and 5,736,152. Erosional systems; And (b) diffusion systems in which the active ingredient spreads at a controlled rate from the polymer as described in US Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. It is also possible to use pump-based hardware delivery systems, some of which are applied to implantation.
[338] The invention is further illustrated by the following examples, which are not intended to limit the invention. The entire contents of the references cited throughout this application, including references in literature, issued patents, published patent applications, and co-pending patent applications, are incorporated herein by reference.
[339] Material and method:
[340] Oligodeoxynucleotides : Natural phosphodiester and phosphorothioate-modified ODN were purchased from Operon Technologies (AIameda, Calif.) And Hybriddon Specialty Products (Milford, Mass.). ODN was tested for endotoxin using LAL-assay (LAL-assay BioWhittaker, Walkersville, MD; lower detection limit: 0.1 EU / ml). For in vitro assays, ODN was diluted in TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA) and stored at -20 ° C. For in vivo use, ODN was diluted in phosphate buffered saline (0.1 M PBS, pH 7.3) and stored at 4 ° C. All dilution procedures were performed using pyrogen-free reagents.
[341] Isolation and Cell Culture of Human PBMC : Ficoll-Paque Density Gradient Centrifugation (Histopaque-1077, as described in Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96: 9305-10). Peripheral blood mononuclear cells (PBMC) were isolated from peripheral blood of healthy volunteers by Sigma Chemical Co., St. Louis, MO). 10% (v / v) heat-inactivated (56 ° C., 1 hour) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine, 100 U / ml penicillin and 100 μg / ml streptomycin (both Gibco BRL Cells were suspended in RPMI 1640 culture medium (complete medium) supplemented by Grand Island, NY. Cells (final concentration 1 × 10 ⁶ cells / ml) were incubated in complete culture medium at 37 ° C. in a 5% CO ₂ wet incubator. ODN and LPS (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, M0) or anti-IgM were used as stimulants. When measuring human NK lysis activity, PBMCs were incubated at 5 × 10 ⁶ / well in 24-well plates. Cultures were harvested after 24 hours and cells were harvested for K562 target cells in a standard 4 hour ⁵¹ Cr-release assay as described above (Ballas et al., 1996 J. Immunol. 157: 1840-1845). Used as effector. In the case of B cell proliferation, ³ H thymidine 1 μCi was added 18 hours before harvesting, and the amount of ³ H thymidine incorporation was measured by scintillation counting on the 5th day. The standard error of triplicate wells was less than 5%.
[342] Flow Cytometry for Human PBMCs: The surface antigens of primate PBMCs were stained as described in Hartmann et al., 1998 J. Pharmacol. Exp. Ther. 285: 920-928. Monoclonal antibodies against CD3 (UCHT1), CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331 [FUN-1]) were identified by Pamineming (Pharmingen, San Diego, CA). It was purchased from the company. Non-specific staining was inhibited using IgG ₁ , κ (MOPC-21) and IgG _2b , κ (Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96: 9305-10). NK cells were identified by CD56 expression on CD3, CD14 and CD19 negative cells, and B cells were identified by CD19 expression. Flow cytometry data of 10,000 cells per sample were obtained on FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). The viability of the cells in the FSC / SSC gate used in the assay was examined by propidium iodide staining (2 μg / ml) and found to be over 98%. Data was analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., StanfDrd, CA).
[343] result:
[344] Example 1: CpG-dependent stimulation of human B cells depends on methylation and ODN length
[345] Human PBMCs were obtained from normal donors and incubated at 2 × 10 ⁵ cells / well for 5 days at the indicated concentrations of the indicated ODN sequences. As shown in Table F, human PBMCs proliferate beyond the background when incubated with several other CpG ODNs, but show some proliferation even when using ODNs that do not contain any CpG motif. The importance of unmethylated CpG motifs in providing optimal immune stimulation using these ODNs is that ODN 1840 (SEQ ID NO: 83) induces 50,603 ³ H-thymidine incorporations and CpG motif methylated (non-CpG) identical. T-rich ODN 1979 (SEQ ID NO: 222) is evidenced by the fact that, while still higher than the background value, it induces lower activity (only 18,618) at the same concentration of 0.6 μg / ml. Reduction of proliferation at higher ODN concentrations may be artificial material of cells consumed under these experimental conditions or may reflect some toxicity of higher ODN concentrations. Interestingly, CpG motifs containing shorter ODNs, such as 13- and 14-mers 2015 and 2016, are also found to be higher in their molar concentrations because, in fact, ODN is added on a mass basis rather than molar concentrations. Though less irritating. This demonstrates that ODN length may be an important determinant of ODN immune action. 1982 (SEQ ID NO: 225), a non-CpG ODN but slightly T-rich ODN (about 30% T), only caused a small amount of background cell proliferation.
[346]
[347] The numbers represent cpm of ³ H-thymidine incorporation for the culture of human PBMCs set up as described above.
[348] Example 2: Concentration-dependent activation of human NK cell activity with thymidine-rich ODN
[349] Human PBMCs were incubated for 24 hours with panels of two different concentrations of different CpG or non-CpG ODN and then NK target cells as described in Ballas et al., 1996 J. Immunol. 157: 1840-1845. The ability of these to kill was tested. Killing was measured as lysis unit or L.U. The human donors used in this experiment had a background of 3.69 L.U. and increased to 180.36 L.U. with the positive control IL-2. CpG oligoin 2006 (SEQ ID NO: 246) induced high levels of NK solubilization at low concentrations of 0.6 and lower concentrations of 6.0. Surprisingly, T-rich ODN in which the 2006 CpG motif was methylated (2117 ODN (SEQ ID NO: 358)) or inverted to GpC (ODN 2137 (SEQ ID NO: 886)) showed strong immunostimulatory function at higher ODN concentrations as shown in Table G. Possessed. This concentration-dependent immune stimulating effect is not a general property of phosphorothioate backbones, as the experiments described below have demonstrated that poly-A ODN is non-irritating at levels above background. Some stimulation is observed with 24-base length ODN, where all base positions are random so that A, C, G and T will occur at a frequency of 25% at each base position (ODN 2182 (SEQ ID NO: 432)). However, the stimulatory effect of this 24-base ODN is greatly enhanced when it is pure poly-T, in which case stimulation is also observed at the lowest concentration of 0.6 μg / ml (ODN 2183 (SEQ ID NO: 433)). Indeed, the stimulatory activity of ODN sequence 433 at this low concentration, unlike the optimal human immune stimulatory ODN of SEQ ID NO: 246, is higher than the activity of any other ODN tested at this low concentration. Indeed, high concentrations of ODN sequence 433 stimulated NK activity more than any other phosphorothioate ODN except for the strong CpG ODN 2142 (SEQ ID NO: 890), which was higher than the lowest limit. If the G content of ODN sequence 246 is increased compared to the T content by the addition of more G, thereby decreasing the proportion of T nucleotides, the immune stimulating effect of ODN is reduced (see ODN 2132 (SEQ ID NO: 373)). Thus, the T content of ODN is an important determinant in its immune stimulating effect. Although poly-T ODN is the most stimulating of non-CpG ODNs, other bases are also important in determining the immune stimulating effects of non-CpG ODNs. ODN 2131 (SEQ ID NO: 372), at least half the base of which is T and without G, is immune stimulating at a concentration of 6 μg / ml, but less active than other T-rich ODN. If 6 A in ODN 2131 (SEQ ID NO: 372) is substituted by 6 G, the immune stimulatory effect of ODN may be increased (see ODN 2130 (SEQ ID NO: 37)).
[350]
[351]
[352]
[353] Example 3: Induction of B Cell Proliferation by T-Rich Non-CpG ODN
[354] To assess the ability of T-rich ODN to activate B cell proliferation, human PBMCs were stained with cytoplasmic dye CSFE and incubated with 0.15 or 0.3 μg / ml of indicated ODN for 5 days, followed by flow cytometry Analyzed. B cells were identified by gating on cells positive for the lineage marker CD19. CpG ODN 2006 was a strong inducer for B cell proliferation and this effect was lowered when the CpG motif was methylated or inverted at an ODN concentration of 0.3 μg / ml as shown in FIG. 1. The base composition of the ODN appears to be important in determining the immune stimulating effect. As exemplified by ODN 2177 (SEQ ID NO: 427), where six Ts present in ODN 2137 (SEQ ID NO: 886) are converted to A, which greatly reduces the immune stimulating effect, reducing the T content of ODN substantially reduces the immune stimulating effect. Decreases. The importance of T in the immune stimulatory effect of ODN is also observed by comparison of ODN 2116 (SEQ ID NO: 357) and 2181 (SEQ ID NO: 431) where the 3 ′ ends of the ODN differ. ODN 2181 with 3 'end poly-T is more irritating than ODN 2116 with 3' end poly-C, despite the fact that both of these ODN have TCGTCG at the 5 'end.
[355] Example 4 B Cell Proliferation Induced by TG Oligonucleotides
[356] The stimulatory effect of the TG motif is shown in FIG. 2. ODN 2137 has the same base composition as ODN 2006, but the CG motifs are all reversed to GC to form CG-free nucleic acids. However, ODN contains six TG dinucleotides. In ODN 2177, all TG dinucleotides of ODN 2137 are converted to AG. Although ODN 2177 contains only 6 adenines, it is actually nonirritating at a concentration of 0.2 μg / ml. In comparison, ODNs of 24 bases in length, each base position is randomly one of 4 bases, and induces proliferation of B cells in excess of 12% at a concentration of 0.2 μg / ml. These results suggest that the stimulatory effect of ODN 2137 is related to the presence of TG dinucleotides, not just the phosphorothioate backbone.
[357] To determine the effect on varying the number of TG dinucleotide motifs, ODN 2200 and ODN 2202 were compared as shown in FIG. 2. The two ODNs contain 18 Ts and 6 Gs, but in ODN 2200 all Gs were contiguous, so there was only one TG dinucleotide, while in ODN 2202 G was divided into GG dinucleotides via ODN, resulting in three TGs. Was present. ODN 2202 was significantly more stimulating than ODN 2200, consistent with the model that three or more TG motifs of ODN are required for optimal stimulatory activity. Stimulation may be achieved at even higher levels when the TG motif is optimized as taught herein.
[358] Example 5 Comparison of Effects of TTG and TTG Motifs
[359] Figure 3 shows the results of experiments performed to study the TG content correlated with the stimulatory effect of ODN in terms of the relative levels of T and G. The figure shows that ODN (ODN 2188 (SEQ ID NO: 905)) where all bases are randomly T or G (ODN 2189 (SEQ ID NO: 906)) where all bases are randomly A or G at a concentration of 0.2 μg / ml It is similar to). However, at higher concentrations of 2 μg / ml, randomized T / G ODN 2188 is considerably more irritating. The latter stimulus level is much lower than that which occurs using globally randomized ODN (ODN 2182 (SEQ ID NO: 432)). The highest stimulus at low concentrations is observed using ODN (ODN 2190 (SEQ ID NO: 907)) with half of the base fixed at T and the other half randomly T or G. Since all other bases are fixed to T, there cannot be any TG motif. The data in FIG. 3 shows that increasing the TG content of ODN increases its stimulatory activity.
[360] In another experiment in which results are not shown herein, ODN 2190 (SEQ ID NO: 907) shows a stimulation of NK activity compared to ODN 2188 (SEQ ID NO: 905) or ODN 2189 (SEQ ID NO: 906).
[361] Example 6-8
[362] Introduction:
[363] In the above, it has been demonstrated that poly T sequences can increase the stimulation of B cells and NK cells. In the following, various effects of non-CpG T-rich ODN and poly C ODN that stimulate human B cells, NK cells and monocytes were investigated.
[364] Material and method:
[365] Oligonucleotide: Phosphorothioate-modified ODN was purchased from ARK Scientific GmbH (Darmstadt, Germany). The sequence used is as follows: 1982: 5'-tccaggacttctctcaggtt-3 '(SEQ ID NO: 225), 2006: 5'-tcgtcgttttgtcgttttgtcgtt-3' (SEQ ID NO: 246), 2041: 5'-ctggtctttctggtttttttctgg-3 '(SEQ ID NO: 282), 2117: 5'-tzgtzgttttgtgtzgttttgtzgtt-3 '(SEQ ID NO: 358), 2137: 5'-tgctgcttttgtgcttttgtgctt-3' (SEQ ID NO: 886), 2183: 5'-ttttttttttttttttttttt-3 '(SEQ ID NO: 433), 2194: 5'-tttttttttttttttttttttttt-3-3 '(SEQ ID NO: 911), 2196: 5'-tttttttttttttttttt-3' (SEQ ID NO: 913), 5126: 5'-ggttcttttggtccttgtct-3 '(SEQ ID NO: 1058), 5162: 5'-tttttttttttttttttttttttttttttt-3' (SEQ ID NO: 1094), 5163: 5'-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-3 '(SEQ ID NO: 1095), 5168: 5'-cccccccccccccccccccccccccccccc-3' (SEQ ID NO: 1096) and 5169: 5'-cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg-3 '(SEQ ID NO: 1097). Most ODN was tested for LPS content using the LAL assay described herein (BioWhittaker, Belgium) (lower detection limit is 0.1 EU / ml). In all assays, ODN was diluted in TE buffer and stored at -20 ° C. All dilution procedures were performed using pyrogen-free reagents.
[366] Cell Proliferation and Cell Culture: Human PBMCs were isolated as described in Example 1 from the peripheral blood of healthy volunteers obtained from Ratingen, Germany, but all other materials were from Life Techno1ogies, Germany. The endotoxin test was purchased and performed. For assaying the activity of B cells, NK cells and monocytes, PBMCs were incubated at 96 × bottom plates in a 37 ° C. wet incubator at a concentration of 2 × 10 ⁶ cells / ml in 200 μl in complete medium. Other ODN, LPS (Sigma) or IL-2 (R & D Systems, USA) were used as stimulators. At the indicated time points, cells were harvested for flow cytometry.
[367] Flow cytometry: MAbs used for staining of surface antigens were CD3, CD14, CD19, CD56, CD69, CD80 and CD86 (all of which were obtained from Pharmingen / Becton Dickinson (Germany)). For monocytes, human IgG (Myltenyi, Germany) was used to block Fc receptors as described in Bauer, M et al 1999 lmlnunology 97: 699. Flow cytometry data for at least 1,000 TPH in the specified subpopulations (B cells, monocytes, NK cells, NK T cells or T cells) were obtained using FACSCalibur (Becton Dickinson). Data was analyzed using the program CellQuest (Becton Dickinson).
[368] NK-mediated cytotoxicity: PBMCs were incubated overnight with or without 6 μg / ml ODN or 100 U / ml IL-2 at 37 ° C. under 5% CO ₂ . The following morning, K-562 target cells were labeled with fluorescent dye CFSE as described in Hartmann, G., and AM Krieg. 2000 J Immunol. 164: 944 for human B cells. PBMCs were added to 2 × 10 ⁵ target cells at different ratios (50: 1,25: 1 and 12.5: 1) and incubated at 37 ° C. for 4 hours. Cells were harvested and incubated with DNA-specific dye 7-AAD (Pharmingen) for detection of apoptotic cells. The results were measured by flow cytometry.
[369] ELISA: PBMC (3 × 10 ⁶ cells / ml) was given specific concentrations of ODN for 24 hours (IL-6, IFN-γ and TNFα) or 8 hours (IL-1β) in 48 well plates under a humidified atmosphere at 37 ° C. Or incubated with LPS. Supernatants were harvested and cytokines were measured using OPTeia ELISA Kit (Pharmingen) for IL-6, IFN-γ and TNFα and Eli-pair ELISA assay (Hoelzel, Germany) for IL-1β according to the manufacturer's protocol. It was.
[370] Example 6: B Cell Activation Induced by ODN Lacking CpG Motif
[371] In the experiment as described in Example 3 above, it was demonstrated that T-rich ODN can activate B cells. Additional ODN, other cell and reagent sources are used to extend the study. In the first set of experiments, the potential activity of various non-CpG T-rich ODNs was compared to the very strong known CpG ODN 2006 (SEQ ID NO: 246). PBMCs of blood donors (n = 2) (2 × 10 ⁶ cells / ml) at the indicated concentrations of ODN 2006 (SEQ ID NO: 246), 2117 (SEQ ID NO: 358), 2137 (SEQ ID NO: 886), 5126 (SEQ ID NO: 1058), and 5162 ( Incubated with SEQ ID NO: 1094). Cells were incubated at 37 ° C. for 48 hours as described above and stained with mAb for CD19 (B cell marker) and CD86 (B cell activation marker, B7-2). Expression was measured by flow cytometry.
[372] Using different concentrations of ODN, as shown in FIG. 4, it was shown that T-rich ODN without CpG motif can induce stimulation of human B cells. ODN 5126 (SEQ ID NO: 1058), which contained only one poly-T sequence but had a T greater than 50%, induced high levels of human B cell activation. Although there are some similarities to SEQ ID NO: 246 (eg, more than 80% T / G content), these ODNs clearly lack any known immunostimulatory CpG motif. Surprisingly, for all tested T-rich ODN, the highest stimulation index is obtained at concentrations of 3 to 10 μg / ml. The highest stimulation index of the ODN tested was achieved by CpG / T-rich ODN sequence 246 of 0.4 μg / ml. Interestingly, activity decreased at high concentrations.
[373] Poly A, Poly C and Poly T sequences were synthesized and tested for biological activity. PBMC (2 × 10 ⁶ cells / ml) of one representative donor (n = 3) was stimulated with the following ODN of 0.4 μg / ml, 1.0 μg / ml or 10.0 μg / ml as described above: 2006 (SEQ ID NO: 246), 2196 (SEQ ID NO: 913) (poly T, 18 bases), 2194 (SEQ ID NO: 911) (poly T, 27 bases), 5162 (SEQ ID NO: 1094) (poly T, 30 bases), 5163 (SEQ ID NO: 1095) (Poly A, 30 bases), 5168 (SEQ ID NO: 1096) (poly C, 30 bases) and 5169 (SEQ ID NO: 1097) (poly CG, 30 bases). Expression of the activity marker CD86 (B7-2) on CD 19-positive B cells was measured by flow cytometry.
[374] 5 demonstrates that at least for poly T ODN, sequence length has a significant impact on its activity. Poly T sequences containing only 18 bases (SEQ ID NO: 913) are more stimulating in a distinct order of SEQ ID NO: 1094> SEQ ID NO: 911> SEQ ID NO: 913 than sequences with 27 bases (SEQ ID NO: 911) or sequences with 30 bases (SEQ ID NO: 1094). Less. In contrast, the poly A (SEQ ID NO: 1095) or poly CG (SEQ ID NO: 1097) sequences do not induce the activation of human B cells. Surprisingly, it was found that the poly C sequence (SEQ ID NO: 1096) can activate human B cells at least at high concentrations (10 μg / ml) (FIG. 5).
[375] Two different T-rich ODNs, 1982 (SEQ ID NO: 225) and 2041 (SEQ ID NO: 282) lacking the CpG motif, were tested for their effect on human B cells. PBMC (n = 2) was incubated with the indicated concentrations of ODN 2006 (SEQ ID NO: 246), 1982 (SEQ ID NO: 225), and 2041 (SEQ ID NO: 282). B cell activation (expression of activity marker CD86) was measured by flow cytometry.
[376] 6 demonstrates that T-rich non-CpG ODN is immunostimulatory at a concentration of 1 μg / ml. Incorporation of the CpG motif into 1982 increased immunostimulatory activity. Extension with the poly T sequence did not increase the immunostimulatory activity of these T-rich ODNs, but rather slightly reduced the potential activity.
[377] Example 7: Immunostimulation of non-CpG ODN is reflected in the increase in NK activation, NK cytotoxicity and monocyte activation.
[378] NK cells and monocytes were tested for their response to non-CpG ODN. PBMC (2 × 10 ⁶ cells / ml) was incubated with 6 μg / ml of the following ODN (n = 4): 2006 (SEQ ID NO: 246), 2117 (SEQ ID NO: 358), 2137 (SEQ ID NO: 886), 2183 (SEQ ID NO: 2) 433), 2194 (SEQ ID NO: 911) and 5126 (SEQ ID NO: 1058). After incubation at 37 ° C. for 24 hours, cells were harvested and stained with mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (initial activation marker) as described above. Expression of CD69 on CD56-positive NK cells was measured by flow cytometry.
[379] FIG. 7 shows that for poly T ODN, a similar effect can be observed as described in FIG. 5. Stimulation of NK cells can be influenced by the length of the ODN as well as B cells. As measured by enhanced expression of the early activation marker CD69, ODN 2183 (SEQ ID NO: 433) (21 bases) induced the activation of NK cells, but the longer ODN 2194 (SEQ ID NO: 911) (27 bases) inhibited activation. Less induced. ODN 5126 (SEQ ID NO: 1058) was also demonstrated to activate human NK cells (FIG. 7).
[380] It is contemplated that the anti-tumor activity of CpG ODN can be assessed by the ability of ODN to increase NK-mediated cytotoxicity in vitro. ODNs containing poly G stretch at the 5 'and 3' ends are known to induce the highest cytotoxicity (Ballas, Z. K., et al. 1996 J Immunol. L57: 1840). To investigate the effect of non-CpG T-rich ODN on NK cytotoxicity, the effects of ODN 2194 (SEQ ID NO: 911) and 5126 (SEQ ID NO: 1058) on NK-mediated lysis were analyzed (FIG. 8). NK-mediated lysis of K-562 target cells was performed using PBMC as described above at 6 μg / ml ODN 2006 (SEQ ID NO: 246), SEQ ID NO: 911 (SEQ ID NO: 911) (poly T, 27 bases) and 5126 (SEQ ID NO: 1058). Incubated with overnight and then measured. SEQ ID NO: 1058 showed a slight increase in lysis by human NK cells when compared to no ODN. SEQ ID NOs: 911 and 246 increased human NK cell cytotoxicity to a much higher degree.
[381] Prior art reports have demonstrated that NK cells as well as NKT cells are mediators of cytotoxic responses to tumor cells (14). Thus, potential activation of human NKT cells by T-rich non-CpG ODN was observed. PBMCs of one representative donor (n = 2) were obtained at 6 μg / ml of ODN 2006 (SEQ ID NO: 246), 2117 (SEQ ID NO: 358), 2137 (SEQ ID NO: 886), 2l83 (SEQ ID NO: 433), 2194 (SEQ ID NO: 913) as described above. And 5126 (SEQ ID NO: 1058) for 24 hours. The mAb was used to stain cells for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (initial activation marker), and then activation of NKT cells was measured by flow cytometry. Expression of CD69 on CD3 and CD56 double-positive cells (NKT cells) is shown.
[382] In FIG. 9, SEQ ID NOs: 911 and 1058 are known to stimulate NKT cells. Similar to NK cells, SEQ ID NO: 911 (poly T) is more active than SEQ ID NO: 1058. In addition, as described above for B cells and NK cells, the length of the ODN has some effect on immunostimulatory potential, and the longer the length of the ODN, the stronger the effect on NKT cells. Similar results were observed for human T cells.
[383] Another type of cell of the immune system that is involved in fighting infection is monocytes. When activated, they release various cytokines and can mature into dendritic cells (DCs), specialized antigen-presenting cells (Roitt, I., J. Brostoff; and D. Male. L998. Immunology. Mosby, London). 10 shows activation of human monocytes after incubating PBMCs with other ODNs. PBMC (2 × 10 ⁶ cells / ml) at 6 μg / ml of 2006 (SEQ ID NO: 246), 2117 (SEQ ID NO: 358), 2137 (SEQ ID NO: 886), 2178 (SEQ ID NO: 1096), 2183 (SEQ ID NO: 433), 2194 (SEQ ID NO: 911). ), 5126 (SEQ ID NO: 1058) and 5163 (SEQ ID NO: 1095) were incubated overnight at 37 ° C. as described above (n = 3). Cells were harvested and stained for CD14 (monocyte marker) and CD80 (B7-1, activation marker). Expression was measured by flow cytometry.
[384] As demonstrated above for NK and B cells, T-rich sequences of different lengths (eg, SEQ ID NO: 433, SEQ ID NO: 911) induce monocyte stimulation at different levels of activity, for example SEQ ID NO: 433> SEQ ID NO: 911. do. Poly A (SEQ ID NO: 1095) and Poly C (SEQ ID NO: 1096) (2178) sequences, in contrast, did not result in activation of monocytes (as measured by upregulation of CD80 at a concentration of 6 μg / ml ODN).
[385] Example 8 Induction of Cytokine Release by Non-CpG ODN
[386] The ability of other T-rich ODNs to influence the cytokine environment was then investigated. PBMC (3 × 10 ⁶ cells / ml) was incubated for 24 hours with or without 1 μg / ml of LPS with 6 μg / ml of indicated ODN or control (n = 2). After incubation supernatant was harvested, TNF-α was measured by ELISA as described above and the results are shown in FIG. 11. PBMCs were incubated with ODN (1.0 μg / ml) indicated as described in FIG. 11 and IL-6 in the supernatant was measured by ELISA and the results are shown in FIG. 12.
[387] 11 and 12 demonstrate that T-rich non-CpG and T-rich CpG ODN can induce secretion of the proinflammatory cytokines TNF-α and IL-6. For both cytokines, ODN 5126 (SEQ ID NO: 1058) was found to be as strong as ODN 2194 (SEQ ID NO: 911) in most analyzes. CpG ODN is known to affect Th1 / Th2 balance by differentially inducing Th1 cytokines (Krieg, A. M. 1999 Biochemica et Biophysica Acta 93321: 1). To test whether T-rich ODN can cause similar migration of Th1 cytokines, IFN- [gamma] production was measured in PBMC. In a first set of experiments, it was demonstrated that ODN sequence 1058 and SEQ ID NO: 911 induced release of a significant amount of this Th1 cytokine IFN-γ, as described for IL-6 and TNF-α. In addition, another proinflammatory cytokine IL-1P was released when PBMCs were incubated with these two ODNs. Although the amount of these cytokines induced by T-rich ODN lacking the CpG motif was less than when CpG ODN sequence 246 was used, the amount induced by T-rich ODN was significantly higher than the control.
[388] Example 9-11
[389] Introduction:
[390] Optimal CpG motifs for immune system activation in non-rodent vertebrates are described herein. Phosphodiester oligonucleotides containing such motifs have been found to strongly stimulate CD86, CD40, CD54 and MHC II expression, IL-6 synthesis and proliferation of primary human B cells. This effect required internalization of oligonucleotide and endosomal maturation. These CpG motifs were associated with sustained induction of NFκB p50 / p65 heterodimers and transcription factor complex active protein-1 (AP-1). Transcription factors were activated by CpG DNA following increased phosphorylation of stress kinase c-jun NH ₂ terminal kinase (JNK) and p38, and activating transcription factor-2 (ATF-2). In contrast to CpG, signaling through B-cell receptors resulted in activation of extracellular receptor kinase (C) and phosphorylation of other isoforms of JNK.
[391] Material and method:
[392] Oligodeoxynucleotides: Unmodified (phosphodiester, PE) and modified nuclease-resistant (phosphoorthioate, PS) ODNs from Operon Technologies (Alameda, Calif.) And Hybridon Specialty Products. (Hybridon Specialty Products; Milford, Mass.). The sequences used are shown in Table H. E. coli DNA and calf thymus DNA were purchased from Sigma Chemical Co., St. Louis, Mo. Genomic DNA samples were purified by extraction with phenol-chloroform-isoamyl alcohol (25/24/1) and ethanol precipitation. DNA was purified from endotoxin by repeated extraction with Triton x-114 (Sigma Chemical Co., St. Louis, MO) and LAL-analyzed (LAL-analytical BioWhittaker, Walkersville, MD; lower detection limit: 0.1 EU / ml) was tested for endotoxin and a high sensitivity assay was performed for endotoxin as described above (lower detection limit: 0.0014 EU / ml) (Hartmann G., and Krieg AM 1999). CpG DNA and LPS induced different patterns of activation in human monocytes (Gene Therapy 6: 893). The endotoxin content of the DNA samples was less than 0.0014 U / ml. E. coli and calf thymus DNA were boiled for 10 minutes and then cooled on ice for 5 minutes to make short chains prior to use. DNA samples were diluted in TE-buffer using pyrogen-free reagents.
[393]
[394] Cell Preparation and Cell Culture: Human Peripheral Blood Mononuclear Cells (PBMC) were described in Ficoll-Fake Density Gradient Centrifugation (Histopaque-1077, as described by Hartmann G., et al 1996 Antisense Nucleic Acid Drug Dev 6: 291). Isolated from peripheral blood of healthy volunteers by Sigma Chemical Co., St. Louis, MO). Cells were 10% (v / v) heat-inactivated (560 ° C., 1 hour) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine, 100 U / ml penicillin and 100 μg / ml streptomycin (all Suspension in RPMI 1640 culture medium (complete medium) supplemented with Gibco BRL, Grand Island, NY). All compounds purchased were tested for endotoxin. Viability before and after incubation with ODN was tested by trypan blue exclusion (normal microscopy) or propidium iodide exclusion (flow cytometry analysis). In all experiments, 96% to 99% of PBMCs survived. Cells (final concentration 1 × 10 ⁶ cells / ml) were incubated in complete medium at 37 ° C. in a 5% CO ₂ wet incubator. Other oligonucleotides (see Table 1, concentrations indicated in the figures), LPS (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, MO) or anti-IgM were used as stimulators. Chloroquine (5 μg / ml; Sigma Chemical Co., St. Louis, Mo.) was used to block endosomal maturation / acidification. At defined time points, cells were harvested for flow cytometry as described below.
[395] In signal transduction studies, human primary B-cells were isolated by immunomagnetic cell sorting using VARIOMACS technology (Miltenyi Biotec Inc., Auburn, Calif.) As described by the manufacturer. In short, PBMCs (Elmer L. DeGowin Blood Center, University of Iowa) obtained from the leukocyte layer of healthy blood donors were incubated with microbeads-linked antibodies to CD19 and transferred to a positive selection column. Purity of B-cells was higher than 95%. After stimulation, whole cell extracts (Westem blot) and nuclear extracts (EMSA) were prepared for signal transduction studies.
[396] For CpG binding protein studies, Ramos cells (human Burkitt lymphoma B cell line, ATCC CRL-1923 or CRL-1596; Interviro1ogy 5: 319-334, 1975) were cultured in complete medium. Untreated cells were harvested and cytoplasmic protein extracts were prepared and analyzed for the presence of CpG oligonucleotide binding protein by EMSA and W-crosslinking as described below.
[397] Flow Cytometry: Surface antigen staining was performed as described in Hartmann G. et al. 1998 J PharmacolExp Ther 285: 920. Monoclonal antibodies against HLA-DR were purchased from Imunotech, Marseille, France. All other antibodies were purchased from Pharmingen, San Diego, Calif .: mAB for CD19 (B43), CD40 (5C3), CD54 (HA58), CD86 (2331 (FUN-1)). IgG ₁ , κ (MOPC-21) and IgG _2b , κ were used as controls for specific staining. Intracellular cytokine staining for IL-6 was performed as described in Hartmann G., and Krieg AM 1999. CpG DNA and LPS induced different activation patterns in human monocytes (Gene Therapy 6: 893). In sum, PBMC (final concentration 1 × 10 ⁶ cells / ml) was incubated in the presence of brefeldin A (final concentration 1 μg / ml, Sigma Chemical Co., St. Louis, MO). After incubation, cells were harvested and FITC-labeled mAB, PE-labeled rat anti-human IL-6 mAb (MQ2-6A3, Pharmingen) and Fix and Perm Kit (Caltag Laboratories, Burlingame, CA) for CD19 (B43) Staining) Flow cytometry data for 5,000 cells per sample were obtained on FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). Non-viable cells were excluded from the analysis by propidium iodide staining (2 μg / ml). Data was analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanfbrd, CA).
[398] Proliferation Assay: CFSE (5- (and-6-) carboxyfluorescein diacetate succinimidyl ester (Molecular Probes, USA)) is a fluorescein-induced intracellular that divides equally among daughter cells upon cell division. It is a fluorescent label. Staining of cells with CFSE enables both quantification and immunoassay (phycoerythin-labeled antibodies) of proliferating cells in mixed cell suspensions. In short, PBMCs were washed twice in PBS, suspended in a final concentration of 5 μM in PBS containing CFSE and incubated at 37 ° C. for 10 minutes. Cells were washed three times with PBS and incubated for 5 days as shown. Flow cytometry was used to identify proliferative CD 19-positive B-cells with reduced CFSE content.
[399] Preparation of Whole Cell, Nuclear and Cytoplasmic Protein Extracts: For Western blot analysis, whole cell extracts were prepared. Primary B-cells were treated with medium, 30 μg / ml of phosphodiester oligonucleotide 2080 (SEQ ID NO: 321) or 2078 (SEQ ID NO: 319) or anti-IgM (10 μg / ml). Cells were harvested, washed twice with ice cold PBS containing 1 mM Na ₃ VO ₄ , lysis buffer (150 mM NaCl, 10 mM TRIS pH 7.4, 1% NP40, 1 mM Na ₃ VO ₄ , 50 mM NaF , 30 mg / ml lupeptin, 50 mg / ml aprotinin, 5 mg / ml antipine, 5 mg / ml pepstatin, 50 μg / ml phenylmethylsulfonylfluoride (PMSF)) and resuspend in ice Incubate for 15 minutes and spin for 10 minutes at 14,000 rpm. Supernatants were frozen at -80 ° C. For the preparation of nuclear extracts, primary B-cells were stored in storage buffer (10 mM HEPES / KOH (pH 7.9), 10 mM KCl, 0.05% NP40, 1.5 mM MgCl ₂ , 0.5 mM dithiothitol (DTT), 0.5 μM PMSF, 30 mg / ml lupeptin, 50 mg / ml aprotinin, 5 μg / ml antipine, 5 mg / ml pepstatin). After 15 minutes incubation on ice, the suspension was centrifuged at 1,000 xg for 5 minutes. The pelleted nuclei were extracted with buffer (20 mM HEPES (pH 7.9), 450 mM NaCl, 50 mM NaF, 20% glycerol, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 30 mg / ml lupetin , 50 mg / ml aprotinin, 5 mg / ml antipine, 5 mg / ml pepstatin) and incubated for 1 hour on ice. The nuclear suspension was centrifuged at 16,000 g for 10 minutes at 40 ° C. Supernatants were harvested and stored at -80 ° C. Cytoplasmic extracts for CpG binding protein studies were prepared from unstimulated Ramos cells and lysed in hypotonic buffer as described for the preparation of nuclear extracts. After centrifugation, the supernatant was removed as a cytoplasmic fraction and stored at -80 ° C. Protein concentration was measured using Bradford protein assay (Bio-Rad, Hercules, CA) according to the manufacturer.
[400] Western blot analysis: Equal concentrations of whole cell protein extracts (25 μg / lane) were added to SDS sample buffer (50 mM Tris-Cl, pH 6.8; 1% β-mercaptoethanol; 2% SDS; 0.1% bromophenol blue; 10% glycerol) and then electrophoresed on a 10% polyacrylamide gel containing 0.1% SDS (SDS-PAGE). After electrophoresis, proteins were transferred to Immobilion-P delivery membranes (Millipore Corp. Bedford, Mass.). Blots were blocked with 5% nonfat dry milk. Specific antibodies against phosphorylated forms of extracellular receptor kinase (ERK), c-jun NH ₂ -terminal kinase (JNK), p38 and active transcription factor-2 (ATF-2) were used (New England BioLabs, Beverly) , MA). Blots were developed in increased chemiluminescent reagent (ECL; Amersham Intemational, Aylesbury, UK) according to the manufacturer's recommended method.
[401] Electrophoretic Mobility Shift Assay (EMSA): dsODN 5 ′ GAT CTA GTG ATG AGT CAG CCG containing AP-1 binding sequence to detect DNA-binding activity of transcription factor active protein-1 (AP-1) and NFκB Nuclear extract (1 μg / lane) using GAT C 3 ′ (SEQ ID NO: 838), and NFκB URE 5 ′ TGC AGG AAG TCC GGG TTT TCC CCA ACC CCC C 3 ′ (SEQ ID NO: 1142) from the c-myc promoter region ) Was analyzed by EMSA. ODN was end labeled with T4-polynucleotide kinase (New England Biolabs) and (Y-32P) ATP (Amersham, Arlington Heights, IL). DNA-binding buffer (10 mM Tris-HCl (pH 7.5), 40 mM MgCl ₂ , 20 mM EDTA, 1 mM dithiothitol, 8% glycerol) containing 20.000-40.000 cpm labeled ODN in a total volume of 10 μl. And 1 μg nuclear protein extract in 100-400 ng of poly (dI-dC)). Specificity for the NFκB band was confirmed by competition studies using oligonucleotides (10-100 ng) cooled from unrelated transcription factor binding sites. For supershift analysis, 2 μg specific antibodies against c-Rel, p50 and p65 were added to the reaction mixture for 30 minutes, followed by the addition of radiolabeled probes. After incubation for 30 minutes, loading buffer was added and probes were electrophoresed on 6% polyacrylamide gels in Tris-borate-EDTA running buffer (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8.0). The gel was dried and then autoradiographed.
[402] UV-crosslinking and denatured protein electrophoresis: Nuclear extracts were incubated with labeled phosphodiester oligonucleotides as described for EMSA. DNA-protein conjugates were crosslinked using UV light for 10 minutes in Stratalinker (Stratagene). Probes were mixed with SDS-sample buffer, boiled for 10 minutes, and loaded onto 7.5% SDS-PAGE. Gels were dried on Whatman paper and autoradiographed. Plot the distance to the molecular weight of the marker protein to obtain a standard curve, which was used to calculate the approximate molecular weight of the cross-linked protein-ODN conjugate. From this value, the molecular weight of the oligonucleotide was subtracted to determine the size.
[403] Example 9 Identification of Optimal CpG Motif for Use Alone or with T-rich ODN
[404] Phosphorothioate oligonucleotides (Yi AK, Chang M., Peckham DW) containing the murine CpG motif GACGTT (SEQ ID NO: 1143) (e.g., 1826 (SEQ ID NO: 69)) and used at active concentrations in murine B-cells , Krieg AM, and Ashman RF 1998. CpG oligodeoxyribonucleotides protect mature splenic B cells from natural apoptosis and stimulate entry into the cell cycle. J Immunol 160: 5898) immunostimulatory activity against human immune cells. Little or no expression. At higher concentrations, this ODN was found to have some stimulatory effect on human B cells.
[405] Initial studies on B cell activation in mice have revealed that CpG-dinucleotides flanked by two 5 'purines and two 3' pyrimidines are optimal for activating phosphodiester oligonucleotides (Krieg AM 1995 et al. 1995 Nature 374: 546, Yi AK, Chang M., et al. 1998 J Immunol 160: 5898).
[406] To identify optimal motifs for stimulation of the immune response in human and non-rodent vertebrates, a series of ODNs were designed and tested for their activity. First, a 20-mer phosphodiester oligonucleotide having a TC at the front 5 'end of the optimal murine CpG motif 5' GACGTT 3 '(SEQ ID NO: 1143) followed by a poly C tail (2079: 5' TCG ACG TTC CCC CCC CCC CC 3 ′ (SEQ ID NO: 320) was designed. When added to human primary B-cells under the same conditions found to be optimal for E. coli DNA (repeated addition at 0, 4 and 18 hours; 30 μg / ml at each time point) these oligonucleotides were human High levels of CD86 expression were stimulated on primary B-cells. To determine the structure-function relationship of the CpG motif, the base adjacent to the CpG dinucleotide was substituted while maintaining both CpG dinucleotides in sequence. Substitution of adenine located between two CpG dinucleotides with thymidine (2080 (SEQ ID NO: 321)) showed slightly higher activity. Substitution by guanosine (2100 (SEQ ID NO: 341)) or cytidine (2082 (SEQ ID NO: 323)) at this position did not show a significant change compared to 2079 (SEQ ID NO: 320). In contrast, the substitution of thymidine 3 ′ with the second CpG dinucleotide by purine guanosine (2099 (SEQ ID NO: 340)) or adenine (2083 (SEQ ID NO: 324)) significantly reduced the activity of the oligonucleotide, but not pyrimidine city Dean only caused some degradation. Also important was thymidine just before the 5 'of the first CpG dinucleotide. Substitution of thymidine by any other base (2105 (SEQ ID NO: 346), guanosine; 2107 (SEQ ID NO: 348), adenine; 2104 (SEQ ID NO: 345), cytidine) significantly reduced the activity of the oligonucleotide. Removal of the first (2108 (SEQ ID NO: 349)) or second (2106 (SEQ ID NO: 347)) CpG dinucleotides also partially reduces activity.
[407] Further addition of the 5 'GTCGn 3' (SEQ ID NO: 1144) CpG motif to the phosphodiester oligonucleotide containing the 8-mer duplex CpG motif (5 'TCGTCGTT 3' (SEQ ID NO: 1145), 2080 (SEQ ID NO: 321)) is a B cell No further increase in CD86 expression in the stomach (SEQ ID NO: 300). Oligonucleotides with the same sequence as 2080 (SEQ ID NO: 321) but with a phosphorothioate backbone showed no activity above background (2116 (SEQ ID NO: 357)). This is surprising because it reports that phosphorothioate backbones significantly stabilize oligonucleotides and enhance CpG-induced stimuli (Krieg AM, Yi AK, Matson S., Waldschmidt TJ, Bishop GA, Teasdale R). , Koretzky GA, and Klinman DM 1995). CpG motifs in bacterial DNA initiate direct B-cell activation (Nature 374: 546). Thus, structure-function analysis of phosphorothioate oligonucleotides containing 5 'GTCGTT 3' (SEQ ID NO: 1144) and 5 'TCGTCGTT 3' (SEQ ID NO: 1145) motifs was further performed, resulting in additional CpG motifs ( 2006 (SEQ ID NO: 246)) tends to increase the activity of phosphorothioate oligonucleotides.
[408] Purified B-cells isolated from peripheral blood by immunomagnetic cell sorting were activated to the same extent as unpurified B-cells in PBMCs by CpG DNA. Thus, activation of B-cells is a primary response and not a second effect caused by cytokines secreted by other cells.
[409] In addition to the co-stimulatory molecule CD86, the functional stage of B-cells is characterized by different surface markers. For example, activated T helper cells stimulate B-cells by CD40 ligation, and intracellular adhesion molecule-1 (ICAM-1, CD54) mediates binding to other immune cells and is a major histocompatibility complex. II (MHC II) serves to present antigen. B cell expression of CD40, CD54 and MHC II was found not to be regulated by CpG oligonucleotide 2080 (SEQ ID NO: 321). Non-CpG regulatory oligonucleotide 2078 (SEQ ID NO: 319) shows no activity compared to medium alone.
[410] When PBMCs were incubated for 5 days in the presence of 2080 (SEQ ID NO: 321) (added at 0 hours, 4 hours, 18 hours and the following morning), the cell size (FSC) of lymphocyte subpopulations increased and gradually became granular (SSC). ) To test if this subpopulation shows proliferative B-cells, the newly isolated PBMCs were stained on day 0 with CFSE (5- (and-6-) carboxyfluorescein diacetate succinimidyl ester), and Incubate with 2080 (SEQ ID NO: 321) for 5 days. CFSE is a fluorescent molecule that binds irreversibly to cellular proteins. Each cell division reduces CFSE staining by 50%. Cells less stained with CFSE (proliferative cells) were found to be mainly CD19-positive B-cells. Oligonucleotide 2080 (SEQ ID NO: 321) induced 60-70% of CD 19 positive B-cells to proliferate within 5 days. Control oligonucleotide 2078 (SEQ ID NO: 319) induced less than 5% of B-cells to proliferate. Proliferating B-cells (less CFSE) showed larger cell size (FSC) and higher granules.
[411] Proliferating B-cells expressed higher levels of CD86 than non-proliferating cells (not shown). Consistent with these results, the panel of oligonucleotides tested above for induction of CD86 expression showed nearly identical B-cell proliferation patterns. Substitution of 3 'thymidine reduced the activity more than substituting thymidine at the intermediate position.
[412] Example 10 B-Cell Activation Requires Maturation / Acidation of Endosomes
[413] It is already known that chloroquine, an inhibitor of endosomal acidification, blocks CpG-mediated stimulation of mouse antigen presenting cells and B-cells but does not affect LPS-mediated effects (Hacker H., et al 1998 Embo J 17: 6230, Yi AK et al 1998 J Immunol 160: 4755, Macfarlane DE, and Manzel L. 1998 J Immunol 160: 1122). It was found that addition of 5 μg / ml chloroquine completely blocked CpG DNA-mediated induction of CD86 expression on primary B-cells (MFI CD86: 2006 (SEQ ID NO: 246), 4.7 vs 1.4; E. coli DNA, 3.4 vs 1.4; Medium alone, 0.9; n = 4). In addition, chloroquine completely inhibited the induction of B-cell proliferation by phosphorothioate oligonucleotide 2006 (SEQ ID NO: 246) measured by CFSE proliferation assay and standard assay. These results suggest that activation of human B-cells by CpG DNA, as with mouse cells, requires the uptake of DNA in the endosomes and subsequent acidification of the endosomes.
[414] Example 11 Analysis of Intracellular Responses Occurring Upon Stimulation of Human B Cells with Optimal Human ODN
[415] Since the requirements of the CpG motif for maximal B-cell activation are substantially different between mouse (GACGTT) (SEQ ID NO: 1143) and human (TCGTCGTT) (SEQ ID NO: 1145), it is of interest whether the basic intracellular signaling response is similar. . Rapid induction of NFκB binding activity was first found in rat B-cells and macrophages (Stacey K. J., et al 1996 J Immunol 157: 21 16, Yi A. K et al 1998 J Immunol 160: 4755). To investigate the NFκB response to CpG DNA in humans, human primary B-cells were isolated from peripheral blood by immunomagnetic cell sorting and CpG oligonucleotide 2080 (SEQ ID NO: 32I), non-CpG control oligonucleotide 2078 (SEQ ID NO: 319). Or incubated with medium. At defined time points, cells were harvested and nuclear extracts prepared. In the presence of CpG oligonucleotides, NFκB binding activity increased within 1 hour and remained below 18 hours (checking for the latest time point). Non-CpG control oligonucleotide 2078 (SEQ ID NO: 319) did not show increased NFκB activity compared to cells incubated with medium alone. NFκB bands were identified by cooling competition, and were found to consist of p50 and p65 subunits by supershift analysis.
[416] Active protein-1 (AP-1) transcription factors are immediately involved in the regulation of early gene and cytokine expression (Karin M. 1995. Regulation of AP-1 by protein kinases activated by mitogen. J Bio1 Chem 270 : 16483). In murine B-cells, AP-1 binding activity is induced in response to CpG DNA (Yi AK, and lGieg AM l998. Rapid induction of protein kinase activated by mitogen by immune stimulating CpG DNA. J Immunol 161: 4493). To determine if these transcription factors are also induced by CpG DNA in humans, AP-1 DNA binding activity in human primary B-cells was examined. Cells were incubated with CpG oligonucleotide 2080 (SEQ ID NO: 321) or control oligonucleotide 2078 (SEQ ID NO: 319). Nuclear extracts were prepared and AP-1 binding activity was analyzed by EMSA. AP-1 binding activity increased within 1 hour and increased for up to 18 hours (checking for the latest time point), indicating a sustained response.
[417] Because AP-1 activity is induced by many stimuli (Angel P., and Karin M. 1991. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072: 129), The upstream signaling pathway of AP-1 is of interest. AP-1 transcription factor complexes integrate several mitogen activated protein kinase (MAPK) pathways (Karin M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270: 16483). Western blots were performed using whole cell extracts from primary B-cells incubated with CpG oligonucleotide 2080 (SEQ ID NO: 321), control 2078 (SEQ ID NO: 319), or medium alone. Specific antigens for phosphorylated forms of JNK, p38, ATF-2 and ERK were used. Strong induction of JNK phosphorylation was found 30 and 60 minutes after exposure to CpG-DNA, but the non-CpG oligonucleotides showed no activity above background. Another stress activated protein kinase (SAPK), protein kinase p38, also phosphorylated within 60 minutes in response to CpG DNA. ATF, a substrate of both p38 and JNK (Gupta S., Campbell D., Derijard B., and Davis RJ1995. Transcription factor ATF2 regulation by the JNK signal transduction pathway.Science 267: 389) -2 showed weak phosphorylation after 30 minutes and increased after 60 minutes. CpG DNA did not substantially induce phosphorylation of ERK. In contrast, anti-IgM, a stimulating B-cell receptor, initiated phosphorylation of ERK. Anti-IgM activated other isoforms of JNK rather than CpG DNA.
[418] Example 12 Assay for Assisted Activation In Vivo
[419] In vitro screening assays have been developed to identify ODN useful as adjuvants in vivo in humans and other non-rodent animals. Since we have identified quantitative and qualitative differences in the activity of different CpG ODNs in mice, we first screened a panel of CpG and non-CpG control ODNs on mouse cells to compare in vivo adjuvant activity with hepatitis B surface antigen (HBsAg). Strongly correlated reliable in vitro assays were identified. Thereafter, at least 250 ODN panels were systematically tested in the corresponding human assays to identify sequences with immunostimulatory activity in vitro. The highest activity ODN in the human assay was then also examined to activate B cell proliferation in chimpanzees and monkeys, and whether they were active as adjuvant using HBsAg in vivo in chimpanzees and cynomolgus monkeys. This study found that the sequence, number and spacing of each CpG motif contributed to the immunostimulatory activity of CpG phosphorothioate ODN. ODN with TC dinucleotide at the 5 'end, followed by three 6-mer CpG motifs (5' GTCGTT 3 '), which are subsequently separated by TT dinucleotide, are highest for human, chimpanzee and rhesus monkey leukocytes Activity was consistently shown. Chimps or monkeys immunized once with this CpG ODN adjuvant for hepatitis B showed 15-fold higher anti-HB antibody titers than those given vaccine alone.
[420] Materials and methods
[421] Oligodeoxynucleotides : Phosphorothioate-modified ODNs were purchased from Operon Technologies (Alamed; Calif.) And Hybriddon Specialty Products (Milford, Mass.). ODN was tested for endotoxin using LAL-analysis (LAL-analysis BioWhittaker, WalkersviIle, MD; lower detection limit: 0.1 EU / ml). For in vitro analysis, ODN was diluted in TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA) and stored at -20 ° C. For in vivo use, ODN was diluted in phosphate buffered saline (0.1 M PBS, pH 7.3) and stored at 4 ° C. All dilutions were performed using pyrogen-free reagents.
[422] Culture of Mouse Spleen Cells: Spleens were extracted from 6-12 week old female BALB / c (The JacksonLaboratory), and 2 × 10 ⁶ splenocytes were removed with 0.2 μM ODN for 4 hours (TNF-α) or 24 hours (IL -6, IFN- [gamma], IL-12) and literature (Yi AK, Klinrian DM, Martin TL, Matson S., and Krieg AM 1996. Rapid immune activation by CpG motifs in bacterial DNA.Systemic induction of IL- 6 transcription through an antioxidant-sensitive pathway. J lmmunol 157: 5394) detected cytokines by ELISA. To assess CpG-induced B cell proliferation, depletion of T cells using anti-Thy-1.2 and complement in spleen cells and centrifugation for lymphocyte M® (Cedarlane Laboratories, Homby, ON, Canada) Incubated for 44 hours with the indicated ODN, followed by Krieg AM, Yi AK, Matson S., Waldschmidt TJ, Bishop GA, Teasdale R., Koretzky GA, and Klinman DM 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 546) and pulsed for 4 hours with 1 μCi of ³ H thymidine. To investigate the lytic activity of NK cells, Ballas ZK, and Rasmussen W. I 993. Lymphokine-activated killer cells.VIL IL-4 induces an NKl.1 + CD8 α + β- TCR-αβ B220 + lymphokine-activated killer subset.J Immunol 150: 17), B cells were depleted in rat spleen cells using magnetic beads coated with goat anti-mouse Ig. Cells were cultured at 5 × 10 ⁶ / well in 24-well plates and harvested at 18 hours and used as effector cells in a standard 4 hour ⁵¹ Cr-release assay against YAC-1 target cells. One unit (LU) is defined as the number of cells required to perform 30% specific lysis.
[423] Assessment of Immunization and Humoral Responses of Mice to HBsAg: Groups of Female BALB / c Mice (n = 5 or 10, Charles River, Montreal, QC) 6-8 Weeks Old (Davis HL, et al., 1998 J Immunol) 160: 870) and immunized against HBsAg. In sum, each mouse was treated with a single adjuvant or alum (Alhydrogel "85", Superfos Biosector, Vedbaek containing 1 μg recombinant HBsAg (Medix Biotech, Foster City, Calif.) And 10 μg of CpG ODN or non-CpG ODN. , Denmark; 25 mg Al3 + / mg HBsAg) in a single intramuscular injection. Control mice were immunized with HBsAg without adjuvant or with alum. Plasma was recovered from mice at various time points after immunization and the end point dilution ELISA (3 repetitions) of Abs specific for HBsAg (anti-HB) as described in Davids H. L et al 1998 J Immunol 160: 870. Quantification by The end point titer was defined as the highest plasma dilution, indicating an absorbance value (OD450) that is twice as high as that of non-immune plasma with a cut-off value of 0.05.
[424] Isolation and Cell Culture of Primate PBMCs: Peripheral blood mononuclear cells (PBMCs) were subjected to Ficoll-Hipque density gradient centrifugation (Histopaque-1077) as described in Hartmann G., et al 1996 Antisense Nucleic Acid Drug Dev 6: 291. , Sigma Chemical Co., St. Louis, MO), isolated from peripheral blood of healthy volunteers, chimpanzees, or rhesus or cynomolgus monkeys. Cells were 10% (v / v) heat-inactivated (56 ° C., 1 hour) FCS (HyClone, Logan, UT), 1.5 mM L-glutamine, 100 U / ml penicillin and 100 μg / ml streptomycin (all Suspension in RPMI 1640 culture medium (complete medium) supplemented with Gibco BRL, Grand Island, NY). Cells (final concentration 1 × 10 ⁶ cells / ml) were incubated in complete medium at 37 ° C. in a 5% CO ₂ wet incubator. ODN and LPS (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, MO) or anti-IgM were used as stimulators. For human NK lysis activity measurements, PBMCs were incubated at 5 × 10 ⁶ / well in 24-well plates. Cultures were harvested after 24 hours and cells were harvested from Ballas ZK, Rasmussen WL, and hieg AM 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA.J Immunol 157: 1840; Ballas ZK, and Rasmussen W. 1993. Lymphokine-activated killer cells.VII.IL-4 induces an NK 1.1 + CD8 α + β-TCR-αβ B220 + Lymphokine-activated killer subset.J Immunol 150: 17). It was used as an effector for K562 target cells in a standard 4 hour ⁵¹ Cr-release assay. In the case of B cell proliferation, 1 HCi of ³ H thymidine was added 18 hours before harvesting, and the amount of ³ H thymidine incorporation was measured by scintillation counting on the 5th day. The standard error of triplicate wells was less than 5%.
[425] Flow Cytometry for Primate PBMCs : The surface antigens of primate PBMCs were stained as described in Hartmann et al., 1998 J. Pharmacol. Exp. Ther. 285: 920. Monoclonal antibodies against CD3 (UCHT1), CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331 [FUN-1]) were identified by Pamineming (Pharmingen, San Diego, CA). It was purchased from the company. Non-specific staining was inhibited using IgG ₁ , κ (MOPC-21) and IgG _2b , κ (Hartmann et al., 1999 Proc. Natl. Acad. Sci USA 96: 9305-10). NK cells were identified by CD56 expression on CD3, CD14 and CD19 negative cells and B cells by CD19 expression. Flow cytometry data of 10,000 cells per sample were obtained on FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). The viability of the cells in the FSC / SSC gate used in the assay was examined by propidium iodide staining (2 μg / ml) and found to be over 98%. Data was analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, CA).
[426] Assessment of Immunization and Humoral Responses of Chimpanzee and Cynomolgus Monkeys to HBsAg: 14 cynomolgus monkeys (2.0-3.5 kg) containing 10 μg HBsAg absorbed in alum (25 mg AP + / mg HBsAg) Immunized with pediatric doses of Engerix-B (SmithKline Beecham Biologicals, Rixensart, BE). It was administered alone (n = 5) or in combination with CpG ODN 1968 (n = 5, 500 μg) or CpG ODN 2006 (SEQ ID NO: 246) (n = 4, 150 μg). Four chimpanzees (10-20 kg) were immunized in the same way, two with the control vaccine (Engerix-B alone) and two with the experimental vaccine (Engerix-B + 1 mg CpG ODN 2006). . All vaccines were administered intramuscularly to the front of the right thigh in a total volume of 1 ml. Monkeys were kept in animal cages at the Primate Research Center (Bogor, Indonesia) and chimpanzees were placed in Bioqual (Rockville, MD). Animal care specialists monitored the animals daily. There was no general deterioration of health or local adverse reactions at the injection site. Plasma was collected by intravenous infusion before and after immunization and frozen at −20 ° C. for antibody analysis. Anti-HB antibodies were detected using a commercially available ELISA kit (Monolisa Anti-HBs; Sanofi-Pasteur, Montreal, QC) and titers expressed in mIU / ml based on comparison with WHO standard definition (Monolisa Anti- HBs Standards; Sanofi-Pasteur).
[427] result
[428] Identification of CpG ODNs with Various Profiles of In Vitro Immune Activity:
[429] Studies show that the correct 5 'and 3' flanking bases of CpG dinucleotides within CpG motifs can affect the level of immune activity of synthetic ODN, but it is not clear whether other CpG motifs may have different immune effects. It turned out. To assess this possibility, CpG ODN against NK lytic activity and their ability to induce B cell proliferation and stimulate the synthesis of TNF-α, IL-6, IFN-γ and IL-12 in rat spleen cells The panels were tested. The immunostimulatory activity of ODN without the CpG motif (ODN 1982 (SEQ ID NO: 225), ODN 1983 (SEQ ID NO: 226)) was negative or weaker than CpG ODN. ODNs with non-optimal CpG motifs (ODN 1628 (SEQ ID NO: 767), ODN1758 (SEQ ID NO: 1)) are ODN (ODN 1760 (SEQ ID NO: 1) containing a CpG motif with two 5 'purines and two 3' pyrimidines on both sides 3), less active than ODN 1826 (SEQ ID NO: 69), ODN 1841 (SEQ ID NO: 84)). ODN 1826, containing two optimal murine CpG motifs (5 'GACGTT 3') (SEQ ID NO: 1143), showed the highest activity at five of the six measured endpoints. Except for ODN 1628, all ODNs generally showed similar activity patterns (NK cell-mediated lysis, B cell proliferation, IL-12, IL-6, TNF-α, IFN-γ). In particular, in this panel specific ODN 1628 exhibits differential induction of IFN-γ, because it contains two G-rich regions, while other activities are relatively less stimulating.
[430] Identification of in vitro assays related to in vivo adjuvant activity:
[431] Since adjuvant activity has endpoints in vivo, it is of interest to anticipate the adjuvant activity of CpG ODN in vivo in an in vitro assay. Therefore, the same ODN used for in vitro endpoints was tested for their adjuvant activity of immunizing mice against HBsAg. Since early studies have shown a strong synergistic effect on CpG ODN and alum adjuvants (PCT Published Patent Application WO98 / 40100), the test was performed both with OND alone and with ODN in combination with alum.
[432] BALB / c mice immunized with HBsAg without adjuvant produced only low titers of anti-HB up to 4 weeks, which were not affected by the addition of control ODN. In contrast, addition of CpG ODN raised anti-HB titers by 5 to 40 fold depending on the sequence used. When alum was added, the titer of anti-HB was approximately 6 times higher than HBsAg alone. In particular, control ODN was unaffected and various CpG ODNs increased this titer by 2 to 36 fold. The results obtained using the other ODN alone had a very strong correlation (r = 0.96) with those obtained using the same ODN and alum. When performing linear regression, there was a very high degree of correlation between some in vitro assays and the in vivo increase of anti-HB titers. Of all the in vitro endpoints investigated, induction of NK lytic activity showed the strongest correlation with adjuvant activity in vivo (r = 0.98 without alum; r = 0.95; p <0.0001). Significant correlations for adjuvant activity were also found in B-cell stimulation (I = 0.84 and 0.7) as well as TNF-α (r = 0.9 and 0.88), IL-12 (F 0.88 and 0.86) and IL-6 (r = 0.85 And 0.91). In vitro assays were IFN-γ secretion (r = 0.57 and 0.68) unless there was sufficient correlation with in vivo results. These results indicate that in vitro assays for NK lytic activity, B cell activation, and production of TNF-α, IL-6, and IL-12 provide valuable in vitro information for predicting adjuvant activity of ODN administered in vivo. Prove the fact
[433] Screening of Phosphorothioate ODN Panels to Activate Human NK Cells:
[434] In this study, it was found that the synthesis of inflammatory cytokines by human PBMCs is induced by a very small amount of endotoxin (induced TNF-α secretion is detectable using only 6 μg / ml of endotoxin, and rat immunity 2 logs more sensitive than cells). In contrast, activation of human B cells with endotoxin and induction of human NK cell lytic activity are low even at high endotoxin concentrations. Based on these results, we select activation of NK cells (lysogenic activity and CD69 expression) and B cells (proliferation and CD86 expression) with low diversity between subjects as the most specific and reproducible assay, Pools of ODN were screened in vitro.
[435] First, various combinations of NK cell-mediated lysis of target cells were studied for the effect of phosphorothioate ODN, including various combinations and substitutions of CpG motifs. For brevity and simplicity of expression, datamins with selected representative CpG and control ODN are shown. Human PBMCs were incubated with several phosphorothioate ODN (6 μg / ml) for 24 hours and tested for their ability to lyse ⁵¹ Cr-labeled K562 cells. Combination of ODN with two 6-mer CpG motifs (5 'GACGn 3' (SEQ ID NO: 1143) or 5 'GTCGn 3' (SEQ ID NO: 1144)) and TpC at the 5 'end of the OND (ODN 1840 5' TCCATGTCGTTCCTGTCGTT 3 '( SEQ ID NO: 83), ODN 1851 5 'TCCTGACGTTCCTGACGTT 3' (SEQ ID NO: 94), or combination with three or more 6-mer motifs without TpC at the 5 'end (ODN 2013 (SEQ ID NO: 253)) exhibit moderate activity. The 5 'TpC is just in front of the 6-mer human CpG motif (5' TCGTCGTT 3 '(SEQ ID NO: 1145)) followed by two 6-mer motifs (ODN 2005 (SEQ ID NO: 245), ODN 2006 (SEQ ID NO: 246), and ODN 2007 (SEQ ID NO: 247)) showed high activity, where the 6-mer CpG motifs were separated from each other and separated from the 5 '8-mer motif by TpT (ODN 2006 (SEQ ID NO: 246)). it was good.
[436] Expression of the activity marker CD69 rapidly matures on the surface of NK cells. To confirm the results from the NK cell lysis assay, PBMCs were incubated with ODN (2 μg / ml) for 18 hours. CD69 expression was examined on CD56 positive NK cells (CD3, CD14 and CD19 negative). Although induction of CD69 expression was less sequence specific than stimulation of functional activity of NK cells, the control ODN (ODN 1982, ODN 2116, ODN 2117, ODN 2010) showed only low activity similar to background. ODN with two human CpG motifs separated by 5 'TTTT 3' (ODN 1965 (SEQ ID NO: 208)) or ODN with four human CpG motifs without gaps (ODN 2013 (SEQ ID NO: 253)) was used for NK cell lysis activity. The activity was relatively higher upon induction of CD69 expression than upon stimulation. Optimal NK cell function activity and CD69 expression were obtained using ODN (ODN 2006 (SEQ ID NO: 246), ODN 2007 (SEQ ID NO: 247)) comprising TpC dinucleotides that precede human CpG motifs and other human motifs in the sequence.
[437] Activity of phosphorothioate ODN to stimulate human B cells: In a preliminary experiment, the proportion of proliferative B cells (CFSE analysis, see the method in section) of co-stimulatory CD86 on B cells was measured by flow cytometry. It was found to correlate with surface expression. Thus, expression of CD86 on B cells was used to screen ODN panels for their immunostimulatory activity. PBMCs were incubated with 0.6 μg / ml ODN. Expression of CD86 (mean fluorescence intensity, MFI) was examined on CD19 positive B cells. Poly C ODN (ODN 2017 (SEQ ID NO: 257)) or ODN without CpG dinucleotide did not stimulate human B cells under these experimental conditions. Phosphorothioate ODN (ODN 2116 (SEQ ID NO: 256)) with one optimal human CpG motif (5 'TCGTCGTT 3' (SEQ ID NO: 1145)) behind TpC had low activity. The presence of one human 6-mer CpG motif (5 'GTCGTT 3' (SEQ ID NO: 1144)) has no active effect. Two of these CpG motifs in the sequence do not exhibit sequence dependent activity (ODN 1960 (SEQ ID NO: 203), ODN 2016 (SEQ ID NO: 256)) or intermediates (ODN 1965 (SEQ ID NO: 208)). When ODN consists of such motifs of copy number 3 or 4 (ODN 2012 (SEQ ID NO: 252), ODN 2013 (SEQ ID NO: 253), ODN 2014 (SEQ ID NO: 254)), intermediate activity against B cells can be detected. On the 5 'end of ODN (ODN 2005 (SEQ ID NO: 245), ODN 2006 (SEQ ID NO: 246), ODN 2007 (SEQ ID NO: 247), ODN 2102 (SEQ ID NO: 343), ODN 2103 (SEQ ID NO: 344)) with two 6-mer CpG motifs Binding of human 8-mer CpG motifs significantly increased the ability of ODN to stimulate B cells. The spacing between single motifs is important. Separation of CpG motif (ODN 2006 (SEQ ID NO: 246)) by TpT was preferred over unseparated CpG motif (ODN 2005 (SEQ ID NO: 2005) and also compared ODN 1965 (SEQ ID NO: 208) with ODN 1960 (SEQ ID NO: 203) . Human 6-mer CpG motif (5 'GTCGTT 3') is optimal mouse 6 when combined with human 8-mer CpG motif on 5 'end (ODN 2006 vs. ODN 2102 (SEQ ID NO: 343) and ODN 2103 (SEQ ID NO: 344)) Better than the -mer CpG motif (5 'GACGn 3' (SEQ ID NO: 246)). (TCG) poly ODN showed inactive or only weak activity, as did CDN O (ODN 2010 (SEQ ID NO: 250)) containing CpG dinucleotide flanked by guanine or other CpG dinucleotides. Considering this together, the results for NK cells and B cells were found to be consistent with the tested ODN, and ODN 2006 (SEQ ID NO: 246) showed the highest immunostimulatory activity against human immune cells.
[438] Comparative analysis of the intensity of CpG phosphorothioate ODN in several primates:
[439] Several CpG motifs were optimal for activating rat and human immune cells. In addition, the number and location of CpG motifs in active phosphorothioate ODN were different in mice and humans. It is of interest to know whether CpG phosphorothioate ODN exhibits similar activity among several primate species. Panels of CpG ODN were compared for their ability to induce B cell proliferation in humans, chimpanzees, and rhesus or cynomolgus monkeys. The ability of ODN to stimulate human B cell proliferation (Table J) correlated well with the ability to induce CD86 expression in B cells. ODN 2006 (SEQ ID NO: 246), which exhibited the highest activity in human B cells and NK cells, was also most active in stimulating B cell proliferation in chimpanzees and rhesus monkeys (Table J). ODN 1968 (SEQ ID NO: 211) and ODN 2006 (SEQ ID NO: 246) provided the highest activation of cynomolgus monkey B-cells in vitro (SI of 25 and 29 at 6 μg ODN / ml, respectively). Surprisingly, CpG ODN 2007 (SEQ ID NO: 247), which shows similarly high activity as the optimal ODN 2006 (SEQ ID NO: 246) in human cells, did not stimulate B cell proliferation in rhesus monkeys or chimpanzees, while ODN 1968 (SEQ ID NO: 211) had low Activity was shown. CpG ODN (ODN 1760 (SEQ ID NO: 3), ODN 1826 (SEQ ID NO: 69)), which was originally found to have high activity in mice, showed little activity in monkeys (Table J).
[440]
[441] PBMCs were prepared from peripheral blood and incubated with 5 days driver ODN (0.6 μg / ml) as indicated. Proliferation was measured by ³ H / thymidine uptake (cpm / 1,000) during the last 18 hours. As measured using CFSE analysis, more than 95% of the proliferating cells were B-cells. Four human probands, six chimpanzees and two rhesus monkeys were tested.
[442] In Vivo Auxiliary Activity of CpG ODN in Chimpanzee and Cynomolgus Monkeys:
[443] In order to evaluate whether CpG ODN having a strong in vitro stimulatory effect on primate cells has detectable adjuvant activity in vivo, cynomolgus monkeys and chimpanzees, either Engerix B alone or added consisting of HBsAg absorbed in alum Immunization was performed with ODN 1968 (500 μg) or ODN 2006 (SEQ ID NO: 246) (1 mg), respectively. Anti-HB titers were 66 and 16 times higher in monkeys and 15 and 3 times higher in chimpanzees, respectively, after 4 weeks and 2 weeks after additional stimulation, compared to controls not receiving CpG ODN. High (Table K). Thus, a clear adjuvant effect of CpG ODN was observed, which was particularly pronounced after a single immunization.
[444] Anti-HBs Response of Primates Immunized to HBsAg Using CpG ODN ³ Anti-HBs (mIU / ml) Primate speciesnCpG ODN4 weeks after initial antigen stimulation2 weeks after additional stimulation Cynomolgus monkey5none15 ± 444880 ± 13113 5ODN 1968 (500 μg) (SEQ ID NO: 211)995 ± 130976449 ± 42094 chimpanzee2none6,113712,4706 2ODN 2006 (1 mg) (SEQ ID NO: 246)125,1359640,16800 Three animals were injected intramuscularly with Engerix B alone or with added CpG ODN containing 10 μg of HBsAg absorbed in alum. Cynomolgus monkeys were further antigen stimulated 10 weeks after initial antigen stimulation and chimpanzees 4 weeks later. Anti-HBs were determined by ELISA analysis, where the values for monkeys were GMT ± SEM (n = 5), but individual values were given for two chimpanzees in each group.

权利要求:
Claims (105)
[1" claim-type="Currently amended] A method of stimulating an immune response comprising administering an immunostimulatory nucleic acid selected from the group consisting of Py-rich nucleic acids and TG nucleic acids to an non-rodent subject in an amount effective to induce an immune response in a non-rodent subject.
[2" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid is a T-rich nucleic acid.
[3" claim-type="Currently amended] The method of claim 2, wherein the T-rich immunostimulatory nucleic acid is a poly T nucleic acid comprising 5′TTTT3 ′.
[4" claim-type="Currently amended] The method of claim 3, wherein the poly T nucleic acid comprises 5′X ₁ X ₂ TTTTX ₃ X ₄ 3 ′ (X ₁ , X ₂ , X ₃ and X ₄ are nucleotides).
[5" claim-type="Currently amended] The method of claim 3, wherein the T-rich immunostimulatory nucleic acid comprises a plurality of poly T nucleic acid motifs.
[6" claim-type="Currently amended] The method of claim 4, wherein X ₁ X ₂ is TT.
[7" claim-type="Currently amended] The method of claim 4, wherein X ₃ X ₄ is TT.
[8" claim-type="Currently amended] The method of claim 4, wherein X ₁ X ₂ is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA and GC.
[9" claim-type="Currently amended] The method of claim 4, wherein X ₃ X ₄ is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA and GC.
[10" claim-type="Currently amended] The method of claim 3, wherein the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 25%.
[11" claim-type="Currently amended] The method of claim 1, wherein the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 35%.
[12" claim-type="Currently amended] The method of claim 1, wherein the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 40%.
[13" claim-type="Currently amended] The method of claim 1, wherein the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 50%.
[14" claim-type="Currently amended] The method of claim 1, wherein the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 60%.
[15" claim-type="Currently amended] The method of claim 1, wherein the T-rich immunostimulatory nucleic acid comprises a nucleotide composition with a T greater than 80%.
[16" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid comprises 20 or more nucleotides.
[17" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid comprises at least 24 nucleotides.
[18" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid has a nucleotide backbone comprising one or more backbone modifications.
[19" claim-type="Currently amended] The method of claim 18, wherein said backbone modification is a phosphorothioate modification.
[20" claim-type="Currently amended] The method of claim 18, wherein said nucleotide backbone is chimeric.
[21" claim-type="Currently amended] The method of claim 18, wherein the nucleotide backbone is wholly modified.
[22" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid does not comprise CpG dinucleotides.
[23" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid does not comprise unmethylated CpG dinucleotides.
[24" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid does not comprise methylated CpG dinucleotides.
[25" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid does not comprise a poly-C sequence.
[26" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid comprises a poly-A sequence.
[27" claim-type="Currently amended] The method of claim 20, wherein said immunostimulatory nucleic acid comprises a poly-G sequence.
[28" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid comprises a nucleotide composition with a C greater than 25%.
[29" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid comprises a peptide composition with an A greater than 25%.
[30" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid is administered orally.
[31" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid is administered topically.
[32" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid is administered to a sustained release device.
[33" claim-type="Currently amended] The method of claim 1, wherein said immunostimulatory nucleic acid is mucosally administered to the mucosal surface.
[34" claim-type="Currently amended] The method of claim 33, wherein the immune response is a mucosal immune response.
[35" claim-type="Currently amended] The method of claim 33, wherein the immune response is a systemic immune response.
[36" claim-type="Currently amended] 34. The group of claim 33, wherein the mucosal surface is comprised of an oral surface, a nasal surface, a rectal surface, a vaginal surface, and an ocular surface. Which is selected from.
[37" claim-type="Currently amended] The method of claim 1, further comprising exposing the subject to an antigen and wherein the immune response is an antigen-specific immune response.
[38" claim-type="Currently amended] The method of claim 37, wherein the nucleic acid vector encoding the antigen and isolated from the immunostimulatory nucleic acid is administered to the subject.
[39" claim-type="Currently amended] The method of claim 37, wherein said antigen is a peptide antigen.
[40" claim-type="Currently amended] The method of claim 1, further comprising isolating the immune cells from the subject, contacting the immune cells with an amount of an immunostimulatory nucleic acid effective to activate the immune cells, and administering the activated immune cells back to the subject.
[41" claim-type="Currently amended] The method of claim 40, wherein the immune cells are white blood cells.
[42" claim-type="Currently amended] The method of claim 41, further comprising contacting the immune cells with the antigen.
[43" claim-type="Currently amended] The method of claim 40, wherein the antigen is selected from the group consisting of tumor antigens, viral antigens, bacterial antigens, and parasitic antigens.
[44" claim-type="Currently amended] The method of claim 40, wherein the immune cells are dendritic cells.
[45" claim-type="Currently amended] The method of claim 1, wherein the method is for treating or preventing asthma in a subject having asthma or at risk of developing asthma.
[46" claim-type="Currently amended] The method of claim 1, wherein the allergy is treated or prevented in a subject suffering from or at risk of developing an allergy.
[47" claim-type="Currently amended] The method of claim 1, wherein the cancer is treated in a subject suffering from cancer.
[48" claim-type="Currently amended] 48. The method of claim 47, wherein the cancer is biliary tract cancer; Brain cancer; Breast cancer; Uterine cancer; Chorionic cancer; Central nervous system cancer (CNS cancer); Colon cancer; Connective tissue cancer; Endometrial cancer; Eye cancer; Stomach cancer; Intraepithelial tumors; Laryngeal cancer; Lymphoma; Hodgkin's lymphoma; Liver cancer; Lung cancer (eg, small cell and non-small cell); Melanoma; Neuroblastoma; Oral cancer; Oral cancer; Ovarian cancer; Pancreatic cancer; Prostate cancer; Rectal cancer; sarcoma; Thyroid cancer; And renal cancer as well as other carcinomas and sarcomas.
[49" claim-type="Currently amended] The method of claim 1, wherein the cancer is selected from the group consisting of bone cancer, brain and central nervous system cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, laryngeal cancer, oral cancer, skin cancer, and testis cancer.
[50" claim-type="Currently amended] 48. The method of claim 47, further comprising administering an anticancer therapy.
[51" claim-type="Currently amended] 51. The method of claim 50, wherein said anticancer therapy is an antibody.
[52" claim-type="Currently amended] The method of claim 47, wherein the subject is a human.
[53" claim-type="Currently amended] The method of claim 47, wherein the subject is selected from the group consisting of dogs, cats, and horses.
[54" claim-type="Currently amended] The method of claim 1, further comprising administering an antibody specific for the cell surface antigen and wherein the immune response causes antigen dependent cytotoxicity (ADCC).
[55" claim-type="Currently amended] The method of claim 1, wherein the method is for treating or preventing an infectious disease in a subject having or at risk of developing an infectious disease.
[56" claim-type="Currently amended] The method of claim 54, wherein the subject is a human.
[57" claim-type="Currently amended] 55. The method of claim 54, further comprising administering the antigen to the subject.
[58" claim-type="Currently amended] The method of claim 57, wherein the antigen is selected from the group consisting of bacterial antigens, viral antigens, parasite antigens, and fungal antigens.
[59" claim-type="Currently amended] The method of claim 56, wherein the subject is selected from the group consisting of dog, cat, horse, cow, pig, sheep, goat, chicken, monkey and fish.
[60" claim-type="Currently amended] 60. The method of claim 59, further comprising administering the antigen to the subject.
[61" claim-type="Currently amended] 60. The method of claim 59, wherein the antigen is a herpes irregularities for (herpesviridae), retro irregularities for (retroviridae), o-maze irregularities for (orthomyroviridae), Toxoplasma (toxoplasma), by a brush loose (haemophilus), Campylobacter (campylobacter), Claus tree Stadium (clostridium), the. E. coli and staphylococcus are derived from a microorganism selected from the group consisting of.
[62" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid is a TG nucleic acid.
[63" claim-type="Currently amended] 63. The method of claim 62, wherein the TG nucleic acid comprises 5'N ₁ X ₁ TGX ₂ N ₂ 3 '.
[64" claim-type="Currently amended] 63. The method of claim 62, wherein the TG nucleic acid comprises 5'N ₁ X ₁ X ₂ TGX ₃ X ₄ N ₂ 3 '.
[65" claim-type="Currently amended] The method of claim 63, wherein N ₁ is a nucleic acid sequence consisting of (11-N ₂ ) to (21-N ₂ ) numbers of nucleotides.
[66" claim-type="Currently amended] The method of claim 63, wherein N ₂ is a nucleic acid sequence consisting of (11-N ₁ ) to (21-N ₁ ) numbers of nucleotides.
[67" claim-type="Currently amended] The method of claim 64, wherein N ₁ is a nucleic acid sequence consisting of (9-N ₂ ) to (19-N ₂ ) numbers of nucleotides.
[68" claim-type="Currently amended] 65. The method of claim 64, wherein N ₂ is a nucleic acid sequence consisting of (9-N ₁ ) to (19-N ₁ ) numbers of nucleotides.
[69" claim-type="Currently amended] The method of claim 63, wherein X ₂ is thymidine.
[70" claim-type="Currently amended] The method of claim 64, wherein X ₃ is thymidine.
[71" claim-type="Currently amended] The method of claim 64, wherein X ₁ X ₂ is a nucleotide selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA and TT.
[72" claim-type="Currently amended] 65. The method of claim 64, wherein X ₃ X ₄ is a nucleotide selected from the group consisting of TT, CT, AT, AG, CG, TC, AC, CC, TA, AA and CA.
[73" claim-type="Currently amended] The method of claim 63, wherein X ₃ X ₄ is a nucleotide selected from the group consisting of TT, TC, TA and TG.
[74" claim-type="Currently amended] The method of claim 1, wherein the cancer is prevented in a subject at risk of developing cancer.
[75" claim-type="Currently amended] 51. The method of claim 50, wherein the anticancer agent is selected from the group consisting of chemotherapeutic agents, immunotherapy agents, and cancer vaccines.
[76" claim-type="Currently amended] A method of preventing a subject's disease comprising regularly administering to the subject an immunostimulatory nucleic acid selected from the group consisting of T-rich nucleic acids and TG nucleic acids to prevent a subject's disease.
[77" claim-type="Currently amended] A method of inducing an innate immune response comprising administering to the subject an immunostimulatory nucleic acid selected from the group consisting of T-rich nucleic acids and TG nucleic acids in an amount effective to activate the innate immune response.
[78" claim-type="Currently amended] A composition comprising a sustained release device comprising an unstimulated CpG motif and comprising an immunostimulatory nucleic acid selected from the group consisting of T-rich nucleic acids and TG nucleic acids.
[79" claim-type="Currently amended] 79. The composition of claim 78, wherein the immunostimulatory nucleic acid has a phosphodiester backbone.
[80" claim-type="Currently amended] A nutritional supplement composition comprising a delivery device selected from the group consisting of capsules, pills and sublingual tablets, free of unmethylated CpG motifs and comprising immunostimulatory nucleic acids selected from the group consisting of T-rich nucleic acids and TG nucleic acids.
[81" claim-type="Currently amended] 81. The composition of claim 80, wherein the immunostimulatory nucleic acid has a phosphorothioate backbone.
[82" claim-type="Currently amended] A composition comprising an immunostimulatory nucleic acid and an antigen selected from the group consisting of T-rich nucleic acids and TG nucleic acids without including unmethylated CpG motifs.
[83" claim-type="Currently amended] A composition comprising an immunostimulatory nucleic acid and an antibiotic selected from the group consisting of T-rich nucleic acids and TG nucleic acids without including unmethylated CpG motifs.
[84" claim-type="Currently amended] 84. The composition of claim 83, wherein the antibiotic is selected from the group consisting of antiviral, antifungal, antiparasitic and antibacterial agents.
[85" claim-type="Currently amended] The method of claim 5, wherein the immunostimulatory nucleic acid comprises at least three, at least four, at least five, at least six, at least seven, or at least eight T motifs.
[86" claim-type="Currently amended] The method of claim 5, wherein each of the at least two poly T motifs of the plurality of poly T motifs comprises at least three contiguous T nucleotide residues.
[87" claim-type="Currently amended] The method of claim 5, wherein each of the at least two poly T motifs of the plurality of poly T motifs comprises at least four contiguous T nucleotide residues.
[88" claim-type="Currently amended] The method of claim 5, wherein the plurality of poly T motifs are three or more motifs each comprising three or more contiguous T nucleotide residues.
[89" claim-type="Currently amended] The method of claim 5, wherein the plurality of poly T motifs are four or more motifs each comprising three or more contiguous T nucleotide residues.
[90" claim-type="Currently amended] The method of claim 5, wherein at least one poly T motif of the plurality of poly T motifs comprises at least 5, at least 6, at least 7, or at least 8 contiguous nucleotide residues.
[91" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid does not comprise two CpG dinucleotides.
[92" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid does not comprise three CpG dinucleotides.
[93" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid comprises two or more poly C sequences of three or more contiguous C nucleotide residues.
[94" claim-type="Currently amended] The method of claim 1, wherein the immunostimulatory nucleic acid does not comprise two poly A sequences of three or more contiguous A nucleotide residues.
[95" claim-type="Currently amended] The isolated of any one of claims 1-29, 32, 40, 41, 64-72 and 85-94 in an amount effective to stimulate an immune response. A pharmaceutical composition comprising an immunostimulatory nucleic acid and a pharmaceutically acceptable carrier.
[96" claim-type="Currently amended] The isolated immunostimulatory nucleic acid and pharmaceutically acceptable of any one of claims 1-29, 32, 40, 41, 64-72 and 85-94. A material composition comprising a carrier.
[97" claim-type="Currently amended] 81. The method of claim 80, wherein the nucleic acid further comprises a plurality of CpG motifs, each of three or more motifs comprising three or more contiguous T nucleotide residues, four or more motifs.
[98" claim-type="Currently amended] 91. The method of claim 90, wherein the plurality of CpG motifs and poly T motifs are scattered.
[99" claim-type="Currently amended] An immunostimulatory nucleic acid and an anticancer agent selected from the group consisting of T-rich nucleic acids and TG nucleic acids, formulated in a pharmaceutically acceptable carrier in an amount effective to treat cancer or reduce the risk of developing cancer. Composition.
[100" claim-type="Currently amended] Selected from the group consisting of T-rich nucleic acids, TG nucleic acids, and C-rich nucleic acids, formulated in a pharmaceutically acceptable carrier in an amount effective to prevent or treat an immune response associated with exposure to a mediator of asthma or allergy. A composition comprising an immunostimulatory nucleic acid and an asthma / allergic agent.
[101" claim-type="Currently amended] SEQ ID NO: 95-136, SEQ ID NO: 138-152, SEQ ID NO: 154-222, SEQ ID NO: 224-245, SEQ ID NO: 247-261, SEQ ID NO: 263-299, SEQ ID NO: 301, SEQ ID NO: 303-4109, SEQ ID NO: 414-420, SEQ ID NO: 424, SEQ ID NO: 426-947 , An immunostimulatory nucleic acid selected from the group consisting of SEQ ID NOs: 959-1022 and SEQ ID NOs: 1024-1093, and a pharmaceutically acceptable carrier.
[102" claim-type="Currently amended] Essentially consisting of 5'M ₁ TCGTCGTTM ₂ 3 ', wherein at least one of C is unmethylated, M ₁ is a nucleic acid having one or more nucleotides, and M ₂ is a nucleic acid having 0-50 nucleotides And an immunostimulatory nucleic acid having less than 100 nucleotides.
[103" claim-type="Currently amended] A pharmaceutical composition comprising an immunostimulatory nucleic acid comprising 5′TCGTCGTT3 ′ wherein at least one of C is not methylated and having less than 100 nucleotides and a phosphodiester backbone, and a sustained release device.
[104" claim-type="Currently amended] 104. The pharmaceutical composition of claim 103, wherein the sustained release device is a microparticle.
[105" claim-type="Currently amended] 103. The pharmaceutical composition of claim 103, further comprising an antigen.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10682365B2|2020-06-16|Combination tumor immunotherapy

---

JP6434204B2|2018-12-05|Compositions and methods relating to the formulation of oligonucleotides

---

US8188254B2|2012-05-29|C-class oligonucleotide analogs with enhanced immunostimulatory potency

---

US6476000B1|2002-11-05|Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides

---

DE69733020T2|2006-02-16|Immunostimulating oligonucleotide conjugates

---

US7115579B2|2006-10-03|Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides

---

US6949520B1|2005-09-27|Methods related to immunostimulatory nucleic acid-induced interferon

---

US20130136771A1|2013-05-30|Oligodeoxynucleotide and its use to induce an immune response

---

AU2011202189B2|2012-05-17|Immunostimulatory oligoribonucleotides

---

JP4989225B2|2012-08-01|Nucleic acid lipophilic conjugate

---

Dalpke et al.2002|Phosphodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo

---

ES2542989T3|2015-08-13|Immuno-regulatory oligonucleotide compounds | to modulate the Toll-like receptor-based immune response

---

US7176296B2|2007-02-13|Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides

---

US9453059B2|2016-09-27|Immunostimulatory oligonucleotides

---

US7585847B2|2009-09-08|Immunostimulatory nucleic acids for the treatment of asthma and allergy

---

KR101251707B1|2013-04-11|CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity

---

EP1511845B1|2012-01-11|Immunostimulatory oligonucleotides and uses thereof

---

US7105495B2|2006-09-12|Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides

---

Mutwiri et al.2004|Strategies for enhancing the immunostimulatory effects of CpG oligodeoxynucleotides

---

US6429199B1|2002-08-06|Immunostimulatory nucleic acid molecules for activating dendritic cells

---

CA2457485C|2012-08-14|Combination motif immune stimulatory oligonucleotides with improved activity

---

RU2468819C2|2012-12-10|New synthetic tlr9 agonists

---

JP5101282B2|2012-12-19|Therapeutic uses of CpG oligodeoxynucleotides for skin diseases

---

DE60132170T2|2008-12-18|MODULATION OF IMMUNOSTIMULATION CAUSED BY CpG OLIGONUCLEOTIDES BY POSITION -AL CHANGING NUCLEOSIDES

---

ES2624859T3|2017-07-17|Immunostimulatory nucleic acid molecules comprising GTCGTT motifs

同族专利:

---

公开号 | 公开日

---

TR200200797T2|2002-10-21|

---

AP1775A|2007-08-28|

---

YU27102A|2005-11-28|

---

PL354997A1|2004-03-22|

---

BG106538A|2002-12-29|

---

US20070066554A1|2007-03-22|

---

SK287400B6|2010-08-09|

---

WO2001022972A2|2001-04-05|

---

AT304361T|2005-09-15|

---

UA77152C2|2006-11-15|

---

RS50325B|2009-09-08|

---

HK1047697A1|2005-12-02|

---

WO2001022972A3|2002-01-17|

---

TR200503031T2|2005-09-21|

---

US20030212026A1|2003-11-13|

---

OA12028A|2006-04-28|

---

EP1700603A3|2007-06-13|

---

EP1700603A2|2006-09-13|

---

CZ20021050A3|2003-01-15|

---

CA2388055A1|2001-04-05|

---

HRP20020249A2|2005-06-30|

---

BG65736B1|2009-09-30|

---

EP1221955A2|2002-07-17|

---

EP1221955B1|2005-09-14|

---

HK1047697B|2005-12-02|

---

NO20021453D0|2002-03-22|

---

MXPA02003108A|2003-10-14|

---

AU780979B2|2005-04-28|

---

AP200603503A0|2006-02-28|

---

ZA200201963B|2003-03-10|

---

US20090191188A1|2009-07-30|

---

AU2005203408A1|2005-08-25|

---

HU0202639A2|2002-12-28|

---

SK3962002A3|2003-04-01|

---

DK1221955T3|2006-01-30|

---

CN1939541A|2007-04-04|

---

RU2245149C2|2005-01-27|

---

BR0014236A|2002-10-15|

---

JP2003510282A|2003-03-18|

---

AP200202484A0|2002-06-30|

---

IL148843D0|2002-09-12|

---

CN1454091A|2003-11-05|

---

WO2001022972A9|2006-12-14|

---

CN101543507A|2009-09-30|

---

AU2005203408B2|2008-10-23|

---

US7271156B2|2007-09-18|

---

DE60022665D1|2005-10-20|

---

CZ301488B6|2010-03-24|

---

EE200200158A|2003-06-16|

---

AU7615300A|2001-04-30|

---

NZ517929A|2004-02-27|

---

EP1221955B9|2005-11-30|

---

DE60022665T2|2006-06-22|

---

ES2248126T3|2006-03-16|

---

RU2002111006A|2004-01-10|

---

NO20021453L|2002-05-27|

---

KR100863630B1|2008-10-15|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
1999-09-25|Priority to US15611399P

---

1999-09-25|Priority to US60/156,113

---

1999-09-27|Priority to US15613599P

---

1999-09-27|Priority to US60/156,135

---

2000-08-23|Priority to US22743600P

---

2000-08-23|Priority to US60/227,436

---

2000-09-25|Application filed by 유니버시티 오브 아이오와 리써치 파운데이션, 콜리 파마슈티칼 게엠베하

---

2002-08-27|Publication of KR20020068509A

---

2006-05-08|First worldwide family litigation filed

---

2008-10-15|Application granted

---

2008-10-15|Publication of KR100863630B1

优先权:

---

申请号 | 申请日 | 专利标题

---

US15611399P| true| 1999-09-25|1999-09-25|

---

US60/156,113|1999-09-25|

---

US15613599P| true| 1999-09-27|1999-09-27|

---

US60/156,135|1999-09-27|

---

US22743600P| true| 2000-08-23|2000-08-23|

---

US60/227,436|2000-08-23|